or
or
Exact

Results for "EPB41"

Variant Events: 15

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EPB41     2-1370-003chr1:
29243750-29243761
ATCTCTCTCTCTATCTCTCTCTintronicDe novo--Yuen2017 G
EPB41     2-1562-003chr1:
29361451-29361451
AGintronicDe novo--Yuen2017 G
EPB41     1-0300-004chr1:
29426969-29426969
TCintronicDe novo--Yuen2017 G
EPB41     DEASD_0198_001chr1:
29379632-29379632
GAexonicDe novosynonymous SNVNM_203343
NM_001166005
NM_001166006
NM_001166007
NM_004437
NM_203342
c.G1548A
c.G1653A
c.G1653A
c.G1026A
c.G1026A
c.G1026A
p.S516S
p.S551S
p.S551S
p.S342S
p.S342S
p.S342S
-8.328E-6DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
EPB41     2-1335-003chr1:
29383620-29383620
GGGCTintronicDe novo--Yuen2017 G
EPB41     1-0357-003chr1:
29216090-29216090
GAintronicDe novo--Yuen2017 G
EPB41     2-1357-003chr1:
29313332-29313332
TCintronicDe novo--Yuen2017 G
EPB41     2-0242-005chr1:
29426699-29426699
TTAintronicDe novo--Yuen2017 G
EPB41     2-1093-009chr1:
29355047-29355047
AGintronicDe novo--Yuen2017 G
EPB41     AU4168306chr1:
29307709-29307709
CTintronicDe novo--Yuen2017 G
EPB41     AU4168306chr1:
29308453-29308453
AGintronicDe novo--Yuen2017 G
EPB41     1-0625-003chr1:
29419556-29419556
TTTTAintronicDe novo--Yuen2017 G
EPB41     1-0269-003chr1:
29426969-29426969
TCintronicDe novo--Yuen2017 G
EPB41     2-1085-004chr1:
29257627-29257627
TAintronicDe novo--Yuen2017 G
EPB41     74-0707chr1:
29385338-29385338
ACexonicInheritednonsynonymous SNVNM_001166005c.A1918Cp.T640P9.666-Patowary2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More