
Results for "OPRK1"

Variant Events: 58

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
OPRK1     mAGRE6014chr8:
19.433.0E-4Cirnigliaro2023 G
OPRK1     2-1174-005Bchr8:
CCACAATAintergenicDe novo--Yuen2017 G
OPRK1     1-0126-003chr8:
AACACATintergenicDe novo--Yuen2017 G
OPRK1     AU2427303chr8:
AACAUTR3De novo--Trost2022 G
OPRK1     NDAR_INVWJ774DL8_wes1chr8:
GTexonicDe novononsynonymous SNVNM_000912
14.09-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
OPRK1     AU046706chr8:
CAintergenicDe novo--Yuen2017 G
OPRK1     MT_165.3chr8:
CTintronicDe novo--Trost2022 G
OPRK1     1-0541-003chr8:
CAintergenicDe novo--Yuen2017 G
OPRK1     2-1148-004chr8:
TTACACACAATACACACACintergenicDe novo--Yuen2017 G
OPRK1     2-1635-004chr8:
AACCACATACACCATATintergenicDe novo--Yuen2017 G
OPRK1     AU2292302chr8:
CTintergenicDe novo--Yuen2017 G
OPRK1     1-0300-004chr8:
TTATACintergenicDe novo--Yuen2017 G
OPRK1     mAGRE6035chr8:
19.433.0E-4Cirnigliaro2023 G
OPRK1     mAGRE6033chr8:
19.433.0E-4Cirnigliaro2023 G
OPRK1     1-0373-003chr8:
CCACCCCATATATATintergenicDe novo--Yuen2017 G
OPRK1     5-0133-003chr8:
TGintergenicDe novo--Yuen2017 G
OPRK1     1-0406-003chr8:
AACintergenicDe novo--Yuen2017 G
OPRK1     2-1322-004chr8:
AACintergenicDe novo--Yuen2017 G
OPRK1     AU4487302chr8:
ATTTATTintergenicDe novo--Yuen2017 G
OPRK1     1-0162-004chr8:
CCACATintergenicDe novo--Yuen2017 G
OPRK1     AU3052301chr8:
TTTTGTintergenicDe novo--Yuen2017 G
OPRK1     1-0638-003chr8:
AGintergenicDe novo--Yuen2017 G
OPRK1     5-0117-003chr8:
TGintergenicDe novo--Yuen2017 G
OPRK1     7-0095-003chr8:
CCGTATATintergenicDe novo--Yuen2017 G
OPRK1     1-0138-003chr8:
CCACACAACACAAGACATATCATintergenicDe novo--Yuen2017 G
OPRK1     2-1398-003chr8:
CCACAACACAAGACATATCATintergenicDe novo--Yuen2017 G
OPRK1     1-0347-003chr8:
CCATAGACATCGTATATintergenicDe novo--Yuen2017 G
OPRK1     7-0059-003chr8:
GAintergenicDe novo--Yuen2017 G
OPRK1     A17chr8:
GTintergenicDe novo--Wu2018 G
OPRK1     1-0332-003chr8:
CCACACAACACAAGACATATCATintergenicDe novo--Yuen2017 G
OPRK1     5-0003-003chr8:
AACACATintergenicDe novo--Yuen2017 G
OPRK1     AU2292301chr8:
CTintergenicDe novo--Yuen2017 G
OPRK1     1-0565-004chr8:
TTATAintergenicDe novo--Yuen2017 G
OPRK1     AU3517301chr8:
TGintergenicDe novo--Yuen2017 G
OPRK1     2-0307-004chr8:
CGintergenicDe novo--Yuen2017 G
OPRK1     PN400253chr8:
19.433.0E-4Leblond2019 E
OPRK1     1-0010-003chr8:
CCCATATintergenicDe novo--Yuen2017 G
OPRK1     AU2089302chr8:
GAintergenicDe novo--Yuen2017 G
OPRK1     2-1632-003chr8:
TCintergenicDe novo--Yuen2017 G
OPRK1     1-0112-003chr8:
CCATAGACATCGTATATintergenicDe novo--Yuen2017 G
OPRK1     2-1342-003chr8:
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
OPRK1     2-0109-003chr8:
CCGTATATintergenicDe novo--Yuen2017 G
OPRK1     1-0206-004chr8:
CCACACCCCATATATintergenicDe novo--Yuen2017 G
OPRK1     1-0455-003chr8:
ACintergenicDe novo--Yuen2017 G
OPRK1     1-0191-004chr8:
CCACAGCATATATATintergenicDe novo--Yuen2017 G
OPRK1     1-0380-003chr8:
TTATACintergenicDe novo--Yuen2017 G
OPRK1     SP0137587chr8:
AGintronicDe novo--Fu2022 E
OPRK1     SP0107580chr8:
TGUTR5De novo--Fu2022 E
Trost2022 G
OPRK1     1-0201-005chr8:
CCAATAintergenicDe novo--Yuen2017 G
OPRK1     AU057503chr8:
CGintergenicDe novo--Yuen2017 G
OPRK1     AU057503chr8:
ACintergenicDe novo--Yuen2017 G
OPRK1     1-0565-003chr8:
AACACCACATintergenicDe novo--Yuen2017 G
OPRK1     1-0595-004chr8:
OPRK1     2-0214-003chr8:
AACACCACATintergenicDe novo--Yuen2017 G
OPRK1     2-0135-004chr8:
AACACATintergenicDe novo--Yuen2017 G
OPRK1     1-1004-003chr8:
CTintergenicDe novo--Yuen2017 G
OPRK1     2-1508-003chr8:
CCATAGACATCGTATATintergenicDe novo--Yuen2017 G
OPRK1     AU2140305chr8:
ACAintergenicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView