or
or
Exact

Results for "FHIT"

Variant Events: 208

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FHIT     AU3053301chr3:
59978770-59978770
GTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0045-003chr3:
59861684-59861684
AAAAAAAAAAAAGintronicDe novo--Yuen2017 G
FHIT     AU4473301chr3:
60382326-60382326
AGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU3636301chr3:
61434344-61434344
GAintergenicDe novo--Yuen2017 G
FHIT     AU3765303chr3:
60018564-60018564
CTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0433-004chr3:
61154232-61154232
GAintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     10-1155-004chr3:
59779263-59779263
TAintronicDe novo--Trost2022 G
FHIT     5-5170-003chr3:
59791992-59791992
GAintronicDe novo--Trost2022 G
FHIT     7-0332-003chr3:
59757433-59757435
CTACintronicDe novo--Trost2022 G
FHIT     3-0489-000chr3:
59765652-59765652
CTintronicDe novo--Trost2022 G
FHIT     9-0027-003chr3:
59852883-59852886
TCTTAAAAAAAAAintronicDe novo--Trost2022 G
FHIT     2-1198-003chr3:
59852883-59852886
TCTTAAAAAAAAintronicDe novo--Trost2022 G
FHIT     1-0018-003chr3:
59852883-59852886
TCTTAAAAAAAAintronicDe novo--Trost2022 G
FHIT     1-0455-003chr3:
59852883-59852886
TCTTAAAAAAAAAintronicDe novo--Trost2022 G
FHIT     REACH000754chr3:
59827414-59827414
AGintronicDe novo--Trost2022 G
FHIT     MSSNG00061-003chr3:
59841880-59841880
CTintronicDe novo--Trost2022 G
FHIT     AU2463301chr3:
59792075-59792075
GAintronicDe novo--Trost2022 G
FHIT     MSSNG00242-003chr3:
59812429-59812429
TCintronicDe novo--Trost2022 G
FHIT     2-1362-003chr3:
59894558-59894561
CAAGTCCGCTTCCintronicDe novo--Trost2022 G
FHIT     7-0095-004chr3:
59894558-59894561
CAAGTCCGCTTCCintronicDe novo--Trost2022 G
FHIT     A14chr3:
60559429-60559429
GAintronicDe novo--Wu2018 G
FHIT     5-5231-003chr3:
59880316-59880316
ACintronicDe novo--Trost2022 G
FHIT     1-0191-004chr3:
60336731-60336731
GAintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU076705chr3:
61181753-61181753
AGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-1123-003chr3:
59881000-59881000
TCintronicDe novo--Trost2022 G
FHIT     1-0928-003chr3:
59872139-59872139
GAintronicDe novo--Trost2022 G
FHIT     1-0928-003chr3:
59872346-59872346
CAintronicDe novo--Trost2022 G
FHIT     AU2577301chr3:
59860011-59860011
GCintronicDe novo--Trost2022 G
FHIT     7-0423-003chr3:
59861990-59861990
GTintronicDe novo--Trost2022 G
FHIT     4-0010-003chr3:
60027327-60027327
AGintronicDe novo--Trost2022 G
FHIT     MSSNG00202-003chr3:
60046635-60046635
AGintronicDe novo--Trost2022 G
FHIT     7-0397-003chr3:
59981876-59981876
GCintronicDe novo--Trost2022 G
FHIT     3-0612-000chr3:
60009425-60009425
TGintronicDe novo--Trost2022 G
FHIT     MSSNG00029-003chr3:
59959133-59959133
CAintronicDe novo--Trost2022 G
FHIT     3-0612-000chr3:
59975671-59975671
AGintronicDe novo--Trost2022 G
FHIT     4-0064-004chr3:
59894764-59894764
CATTTTTTintronicDe novo--Trost2022 G
FHIT     MSSNG00023-004chr3:
59918487-59918487
GAintronicDe novo--Trost2022 G
FHIT     MSSNG00018-004chr3:
60168478-60168478
TGintronicDe novo--Trost2022 G
FHIT     AU030804chr3:
60294490-60294490
ATintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-1504-003chr3:
60179789-60179789
ATintronicDe novo--Trost2022 G
FHIT     AU030804chr3:
61473139-61473139
GAintergenicDe novo--Yuen2017 G
FHIT     MSSNG00213-003chr3:
60140986-60140986
GAintronicDe novo--Trost2022 G
FHIT     7-0352-003chr3:
60166155-60166155
CTintronicDe novo--Trost2022 G
FHIT     1-0469-003chr3:
60136319-60136319
AGintronicDe novo--Trost2022 G
FHIT     2-1408-003chr3:
60905515-60905515
GAintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     MSSNG00196-003chr3:
60139739-60139739
GAintronicDe novo--Trost2022 G
FHIT     1-0568-003chr3:
60061673-60061674
AATTintronicDe novo--Trost2022 G
FHIT     1-0469-003chr3:
60136310-60136316
AAGTCGCGGintronicDe novo--Trost2022 G
FHIT     5-0068-003chr3:
60270715-60270715
GAintronicDe novo--Trost2022 G
FHIT     2-1694-003chr3:
60274948-60274948
GCintronicDe novo--Trost2022 G
FHIT     2-1437-004chr3:
60244923-60244924
ATGAintronicDe novo--Trost2022 G
FHIT     MSSNG00047-004Achr3:
60259199-60259199
GTintronicDe novo--Trost2022 G
FHIT     REACH000194chr3:
60199752-60199752
AGintronicDe novo--Trost2022 G
FHIT     MSSNG00337-003chr3:
60209920-60209920
CAintronicDe novo--Trost2022 G
FHIT     MT_18.3chr3:
60182252-60182252
TCintronicDe novo--Trost2022 G
FHIT     AU3888302chr3:
60051296-60051296
TGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU3912302chr3:
59994333-59994333
CGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     REACH000163chr3:
60196218-60196218
CTintronicDe novo--Trost2022 G
FHIT     5-5159-003chr3:
60416223-60416223
TAintronicDe novo--Trost2022 G
FHIT     5-5040-003chr3:
60423723-60423725
CATCintronicDe novo--Trost2022 G
FHIT     1-1155-003chr3:
60377447-60377447
GCintronicDe novo--Trost2022 G
FHIT     2-1764-004chr3:
60414688-60414692
CTGCTCintronicDe novo--Trost2022 G
FHIT     MT_34.3chr3:
60359701-60359701
TAintronicDe novo--Trost2022 G
FHIT     2-1481-003chr3:
60372455-60372455
GCintronicDe novo--Trost2022 G
FHIT     3-0777-000chr3:
60295468-60295468
TCintronicDe novo--Trost2022 G
FHIT     REACH000754chr3:
60355124-60355124
TCintronicDe novo--Trost2022 G
FHIT     1-1055-003chr3:
60515889-60515889
TCintronicDe novo--Trost2022 G
FHIT     5-0019-003chr3:
60516832-60516832
GCintronicDe novo--Trost2022 G
FHIT     MT_155.3chr3:
60484598-60484598
GAintronicDe novo--Trost2022 G
FHIT     1-0111-003chr3:
60509835-60509835
AGintronicDe novo--Trost2022 G
FHIT     MSSNG00395-003chr3:
60469907-60469907
GAintronicDe novo--Trost2022 G
FHIT     MSSNG00351-004chr3:
60480684-60480684
GAintronicDe novo--Trost2022 G
FHIT     1-0485-003chr3:
60951778-60951778
CTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     REACH000681chr3:
60446642-60446642
GAintronicDe novo--Trost2022 G
FHIT     2-1129-003chr3:
60990700-60990700
AGintronicDe novo--Yuen2016 G
Yuen2017 G
FHIT     5-5175-003chr3:
60462043-60462043
GCintronicDe novo--Trost2022 G
FHIT     MSSNG00040-003chr3:
60586674-60586674
GAintronicDe novo--Trost2022 G
FHIT     1-0700-003Achr3:
60592338-60592338
GAintronicDe novo--Trost2022 G
FHIT     7-0381-003chr3:
60567121-60567121
GTintronicDe novo--Trost2022 G
FHIT     5-1006-003chr3:
60578007-60578007
ACintronicDe novo--Trost2022 G
FHIT     REACH000409chr3:
60535527-60535527
CTintronicDe novo--Trost2022 G
FHIT     H3E8D_01chr3:
60556498-60556498
GAintronicDe novo--Trost2022 G
FHIT     2-0264-004chr3:
60216665-60216665
TCintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     3-0007-000chr3:
60519128-60519128
GTintronicDe novo--Trost2022 G
FHIT     MT_73.3chr3:
60519605-60519605
GCintronicDe novo--Trost2022 G
FHIT     3-0740-000Achr3:
60724909-60724909
TCintronicDe novo--Trost2022 G
FHIT     2-1577-003chr3:
60450547-60450547
AGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU2410302chr3:
59819775-59819775
GAintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     MSSNG00099-004chr3:
60732691-60732691
CTintronicDe novo--Trost2022 G
FHIT     7-0161-003chr3:
60472164-60472164
TCintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU2787301chr3:
60927795-60927795
TCintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     REACH000349chr3:
60679946-60679946
CAintronicDe novo--Trost2022 G
FHIT     4-0062-003chr3:
60691132-60691132
GAintronicDe novo--Trost2022 G
FHIT     MSSNG00063-003chr3:
60601939-60601939
CTintronicDe novo--Trost2022 G
FHIT     1034chr3:
60667003-60667003
GAintronicDe novo--Trost2022 G
FHIT     2-1213-003chr3:
59837468-59837468
CAintronicDe novo--Yuen2017 G
FHIT     SJD_50.4chr3:
60593675-60593675
AGintronicDe novo--Trost2022 G
FHIT     5-0140-003chr3:
60451623-60451623
ACintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     SJD_50.4chr3:
60594637-60594637
GCintronicDe novo--Trost2022 G
FHIT     AU2310301chr3:
60892242-60892242
TAintronicDe novo--Trost2022 G
FHIT     REACH000681chr3:
60896993-60896993
TCintronicDe novo--Trost2022 G
FHIT     1-0683-004chr3:
60221939-60221939
ACintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AM02ZF-03chr3:
60884646-60884646
CTintronicDe novo--Trost2022 G
FHIT     1-0271-004chr3:
61120609-61120609
CTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU2310301chr3:
60891720-60891720
TCintronicDe novo--Trost2022 G
FHIT     7-0233-003chr3:
60815021-60815022
ATCAintronicDe novo--Trost2022 G
FHIT     5-0512-003chr3:
60842700-60842700
CTintronicDe novo--Trost2022 G
FHIT     AU2283301chr3:
60790500-60790500
AGintronicDe novo--Trost2022 G
FHIT     AU2697301chr3:
60808376-60808377
ATAintronicDe novo--Trost2022 G
FHIT     1-1100-003chr3:
61004069-61004069
TGintronicDe novo--Trost2022 G
FHIT     1-1116-003chr3:
61019480-61019480
TCintronicDe novo--Trost2022 G
FHIT     1-0738-003chr3:
60952946-60952946
GAintronicDe novo--Trost2022 G
FHIT     MT_186.4chr3:
60954839-60954839
GAintronicDe novo--Trost2022 G
FHIT     MSSNG00027-003chr3:
60929349-60929349
AGintronicDe novo--Trost2022 G
FHIT     MSSNG00337-003chr3:
60936739-60936739
GTintronicDe novo--Trost2022 G
FHIT     REACH000655chr3:
60913425-60913425
CAintronicDe novo--Trost2022 G
FHIT     1-1204-004chr3:
60924820-60924820
TCintronicDe novo--Trost2022 G
FHIT     1-0242-003chr3:
61162808-61162808
CAintronicDe novo--Trost2022 G
FHIT     MSSNG00328-003chr3:
61195336-61195336
TCintronicDe novo--Trost2022 G
FHIT     MSSNG00419-003chr3:
61149653-61149653
AGintronicDe novo--Trost2022 G
FHIT     3-0198-000chr3:
61161060-61161060
TAintronicDe novo--Trost2022 G
FHIT     4-0102-003chr3:
61083542-61083542
TAintronicDe novo--Trost2022 G
FHIT     AU4327303chr3:
60568913-60568913
TGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     7-0320-003chr3:
61102932-61102932
CTintronicDe novo--Trost2022 G
FHIT     REACH000368chr3:
61062882-61062882
CTintronicDe novo--Trost2022 G
FHIT     2-1327-004chr3:
61369029-61369029
CGintergenicDe novo--Yuen2017 G
FHIT     4-0082-003chr3:
61079601-61079601
TCintronicDe novo--Trost2022 G
FHIT     2-1525-003chr3:
61487944-61487944
TCintergenicDe novo--Yuen2017 G
FHIT     1-0995-003chr3:
60417102-60417102
GTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     MSSNG00421-006chr3:
61210160-61210160
GAintronicDe novo--Trost2022 G
FHIT     MSSNG00101-004chr3:
61207302-61207303
AGAintronicDe novo--Trost2022 G
FHIT     MSSNG00127-003chr3:
61208931-61208931
CTintronicDe novo--Trost2022 G
FHIT     AU073005chr3:
60351483-60351483
ACintronicDe novo--Yuen2017 G
FHIT     A24chr3:
59992714-59992714
ATintronicDe novo--Wu2018 G
FHIT     A24chr3:
59992719-59992719
TCintronicDe novo--Wu2018 G
FHIT     1-0046-003chr3:
60687161-60687161
CGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU2000305chr3:
60873731-60873731
TCintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0303-004chr3:
60214955-60214955
GAintronicDe novo--Yuen2017 G
FHIT     2-1406-003chr3:
60324637-60324637
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
FHIT     AU3680301chr3:
60063460-60063460
AGintronicDe novo--Yuen2017 G
FHIT     2-1290-004chr3:
61475165-61475165
CTintergenicDe novo--Yuen2017 G
FHIT     2-1497-003chr3:
60911122-60911122
TCintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU3154302chr3:
61005302-61005302
TCintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0450-003chr3:
61055856-61055856
GCintronicDe novo--Yuen2017 G
FHIT     1-0019-004chr3:
60191710-60191710
AAATAAAAATintronicDe novo--Yuen2017 G
FHIT     11252.p1chr3:
60183760-60183760
CTintronicDe novo--Turner2016 G
FHIT     13023.p1chr3:
60224371-60224371
GAintronicDe novo--Turner2016 G
FHIT     AU4433301chr3:
60720177-60720177
GAintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     7-0143-003chr3:
60342858-60342858
AGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0871-003chr3:
60344775-60344775
AGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0377-003chr3:
60089066-60089066
CTintronicDe novo--Yuen2017 G
FHIT     5-0055-003chr3:
59894760-59894760
AAAGAACATintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-1411-003chr3:
60324540-60324540
CTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU3763305chr3:
61296964-61296964
TCintergenicDe novo--Yuen2017 G
FHIT     2-1180-003chr3:
60355462-60355462
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
FHIT     7-0023-003chr3:
60761863-60761863
CTintronicDe novo--Yuen2017 G
FHIT     1-0495-003chr3:
61485971-61485971
TCintergenicDe novo--Yuen2017 G
FHIT     AU2863303chr3:
60991228-60991228
CTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0440-003chr3:
60042153-60042153
CTintronicDe novo--Yuen2017 G
FHIT     2-0158-003chr3:
59972158-59972158
CTintronicDe novo--Yuen2017 G
FHIT     2-0296-003chr3:
60888508-60888508
GCintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-1581-003chr3:
59779753-59779753
CGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0556-003chr3:
61230830-61230830
GTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU002903chr3:
60205070-60205070
AGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-1436-003chr3:
60816072-60816072
CTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-1501-003chr3:
59986176-59986176
CGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU3866301chr3:
59888192-59888192
CTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0479-006chr3:
61317281-61317293
GAGGTAACACTTAGintergenicDe novo--Yuen2017 G
FHIT     AU4231301chr3:
61349605-61349605
TGintergenicDe novo--Yuen2017 G
FHIT     1-0541-004chr3:
59894692-59894692
CAintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0534-003chr3:
61121910-61121910
CTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-1178-003chr3:
60553738-60553738
GTintronicDe novo--Yuen2017 G
FHIT     AU021204chr3:
59843700-59843700
ACintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU021204chr3:
59955529-59955529
ATintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-1000-003chr3:
61393733-61393758
AAGAGAGAGAGAGACAGAGAGAGAGAAAGAGAGAGAGACAGAGAGAGAGAintergenicDe novo--Yuen2017 G
FHIT     AU3398301chr3:
60409808-60409808
ACintronicDe novo--Yuen2017 G
FHIT     5-0033-004chr3:
60015229-60015229
CGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0906-003chr3:
60305468-60305468
TGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-1353-003chr3:
60213489-60213489
CGintronicDe novo--Yuen2016 G
Yuen2017 G
FHIT     AU054103chr3:
60062810-60062810
AGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-0238-003chr3:
60470414-60470414
AATACAAAAATTAACTCintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     13843.p1chr3:
60446809-60446809
AAAATACTCTTintronicMaternal--Wilfert2021 G
FHIT     AU4412302chr3:
60981169-60981169
CGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU4072303chr3:
61349359-61349359
CTintergenicDe novo--Yuen2017 G
FHIT     7-0191-003chr3:
59887088-59887088
AGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     5-0117-003chr3:
59949065-59949065
ACintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     5-0117-003chr3:
59962937-59962937
AGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0285-004chr3:
60030834-60030834
CTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     1-0043-004chr3:
61363499-61363499
CTintergenicDe novo--Yuen2017 G
FHIT     AU3646301chr3:
59789548-59789548
GAintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU058103chr3:
60973659-60973659
CTintronicDe novo--Yuen2017 G
FHIT     2-0318-004chr3:
60570003-60570003
TGintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-1696-003chr3:
61423505-61423505
TGintergenicDe novo--Yuen2017 G
FHIT     1-0546-003chr3:
60590832-60590845
AACACACACACACAAACACACACACAintronicDe novo--Yuen2017 G
FHIT     2-1246-003chr3:
60019634-60019634
CAintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-1210-003chr3:
60750538-60750538
TCintronicDe novo--Yuen2017 G
FHIT     2-0238-004chr3:
60470414-60470414
AATACAAAAATTAACTCintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU054303chr3:
59819743-59819743
ACintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-0244-004chr3:
61378525-61378525
CTintergenicDe novo--Yuen2017 G
FHIT     2-1592-003chr3:
60589917-60589917
GAintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     AU3900301chr3:
61345070-61345070
CAintergenicDe novo--Yuen2017 G
FHIT     AU3760301chr3:
60759460-60759460
TCintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-1195-003chr3:
60174733-60174733
CAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
FHIT     AU4234302chr3:
60259203-60259203
GCintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-1702-003chr3:
60824266-60824266
TCintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     2-1127-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2016 G
Yuen2017 G
FHIT     2-0081-003chr3:
60656489-60656489
GTintronicDe novo--Trost2022 G
Yuen2017 G
FHIT     7-0100-004chr3:
59861586-59861586
GCintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More