or
or
Exact

Results for "NKAIN2"

Variant Events: 120

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NKAIN2     3-0246-000chr6:
125088568-125088568
CGintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     AU005214chr6:
124353831-124353831
CTintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     AU1955302chr6:
125212677-125212677
CTintergenicDe novo--Yuen2017 G
NKAIN2     AU4483301 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
NKAIN2     2-1456-004chr6:
124798044-124798047
TACATintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     AU4186302chr6:
124164787-124164787
AGintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     1-0261-004chr6:
124370915-124370915
CAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     AU051503chr6:
124340270-124340271
ACAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     1-0261-004chr6:
124365612-124365612
GAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     1-0325-003chr6:
124921570-124921570
TAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     2-1381-003chr6:
124720621-124720621
CTintronicDe novo--Yuen2017 G
NKAIN2     2-0319-004chr6:
124375821-124375821
CAintronicDe novo--Yuen2017 G
NKAIN2     AU2975301chr6:
124245200-124245200
TCintronicDe novo--Yuen2017 G
NKAIN2     AU4356302chr6:
124347353-124347353
TAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     2-1093-003chr6:
124170177-124170177
AGintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     2-0278-003chr6:
124469738-124469738
GAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     A15chr6:
124684047-124684047
CTintronicDe novo--Wu2018 G
NKAIN2     AU2951302chr6:
124784108-124784108
CTintronicDe novo--Yuen2017 G
NKAIN2     AU0636303chr6:
124886504-124886504
ACintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     2-1646-003chr6:
124441932-124441932
TAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     AU3721302chr6:
124248071-124248071
TAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     AU003403chr6:
124777289-124777289
TCintronicDe novo--Yuen2017 G
NKAIN2     MSSNG00338-004chr6:
124171056-124171056
TAintronicDe novo--Trost2022 G
NKAIN2     1-0651-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
NKAIN2     MSSNG00362-003chr6:
124308747-124308747
TCintronicDe novo--Trost2022 G
NKAIN2     AU2310301chr6:
124320936-124320936
AGintronicDe novo--Trost2022 G
NKAIN2     2-0264-004chr6:
124845033-124845033
TAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     MSSNG00367-004 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NKAIN2     SJD_69.3chr6:
124275373-124275373
GAintronicDe novo--Trost2022 G
NKAIN2     1-0876-003Achr6:
124250172-124250172
GAintronicDe novo--Trost2022 G
NKAIN2     AU2283301chr6:
124271369-124271369
CGintronicDe novo--Trost2022 G
NKAIN2     REACH000616chr6:
124187589-124187589
TCintronicDe novo--Trost2022 G
NKAIN2     2-1519-006chr6:
124239753-124239753
GCintronicDe novo--Trost2022 G
NKAIN2     2-1522-003chr6:
124499281-124499281
GAintronicDe novo--Trost2022 G
NKAIN2     2-1237-002chr6:
124520487-124520487
AGintronicDe novo--Trost2022 G
NKAIN2     2-1781-003chr6:
124450596-124450596
TCintronicDe novo--Trost2022 G
NKAIN2     AU4072303chr6:
124290052-124290052
TAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     MSSNG00127-003chr6:
124471546-124471546
TCintronicDe novo--Trost2022 G
NKAIN2     2-1740-003chr6:
124428521-124428521
AGintronicDe novo--Trost2022 G
NKAIN2     1-0552-004chr6:
124448214-124448214
AGintronicDe novo--Trost2022 G
NKAIN2     1-1230-003chr6:
124339147-124339147
TAintronicDe novo--Trost2022 G
NKAIN2     MT_40.3chr6:
124422373-124422373
AGintronicDe novo--Trost2022 G
NKAIN2     AU3905301chr6:
124937146-124937147
TGTintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     AU4199303chr6:
124819377-124819377
AGintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     MT_183.4chr6:
124637087-124637087
TCintronicDe novo--Trost2022 G
NKAIN2     5-5025-004chr6:
124652861-124652861
AGintronicDe novo--Trost2022 G
NKAIN2     AU2308301chr6:
124579999-124579999
TCintronicDe novo--Trost2022 G
NKAIN2     2-1548-003chr6:
124635380-124635380
AGintronicDe novo--Trost2022 G
NKAIN2     7-0051-003chr6:
124558655-124558655
AGintronicDe novo--Trost2022 G
NKAIN2     3-0497-000chr6:
124579114-124579114
AGintronicDe novo--Trost2022 G
NKAIN2     3-0270-000chr6:
124523524-124523524
TCintronicDe novo--Trost2022 G
NKAIN2     1-1050-003chr6:
124548297-124548297
TCintronicDe novo--Trost2022 G
NKAIN2     2-1408-004chr6:
124901053-124901054
GCAGintronicDe novo--Trost2022 G
NKAIN2     AU4487302chr6:
124819747-124819747
GCintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     2-1764-004chr6:
124904717-124904717
CAintronicDe novo--Trost2022 G
NKAIN2     7-0178-003chr6:
124826248-124826248
AGintronicDe novo--Trost2022 G
NKAIN2     2-1270-005chr6:
124826251-124826251
TCintronicDe novo--Trost2022 G
NKAIN2     MSSNG00016-003chr6:
124734920-124734920
TGintronicDe novo--Trost2022 G
NKAIN2     MSSNG00336-004chr6:
124782682-124782682
CTintronicDe novo--Trost2022 G
NKAIN2     7-0191-003chr6:
124333214-124333234
ATAAAATGCATATAATTAAAGAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     REACH000327chr6:
124698043-124698043
AGintronicDe novo--Trost2022 G
NKAIN2     MSSNG00334-004chr6:
124716886-124716886
TCintronicDe novo--Trost2022 G
NKAIN2     2-1548-003chr6:
124911669-124911681
GAGCCGATGGATAACTCAGTTACAGGintronicDe novo--Trost2022 G
NKAIN2     4-0075-003chr6:
124911669-124911681
GAGCCGATGGATAACTCAGTTACAGGintronicDe novo--Trost2022 G
NKAIN2     2-0223-003chr6:
124911669-124911681
GAGCCGATGGATAACTCAGTTACAGGintronicDe novo--Trost2022 G
NKAIN2     2-1377-003chr6:
124911669-124911681
GAGCCGATGGATAACTCAGTTACAGGintronicDe novo--Trost2022 G
NKAIN2     2-1408-004chr6:
124911666-124911666
TGintronicDe novo--Trost2022 G
NKAIN2     2-1377-003chr6:
124911666-124911666
TGintronicDe novo--Trost2022 G
NKAIN2     1-0497-003chr6:
125020570-125020570
AGintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     1-0262-003Achr6:
124908522-124908522
CTintronicDe novo--Trost2022 G
NKAIN2     2-1408-004chr6:
124911641-124911646
GGGATGAACACintronicDe novo--Trost2022 G
NKAIN2     MSSNG00256-005chr6:
124928773-124928773
CTintronicDe novo--Trost2022 G
NKAIN2     AU2863302chr6:
124480865-124480865
AGintronicDe novo--Yuen2017 G
NKAIN2     AU2320301chr6:
124958279-124958279
ACintronicDe novo--Trost2022 G
NKAIN2     1-1215-003chr6:
124912844-124912844
TCintronicDe novo--Trost2022 G
NKAIN2     1-1183-003chr6:
124916693-124916693
CTintronicDe novo--Trost2022 G
NKAIN2     2-1548-003chr6:
124911684-124911684
GTintronicDe novo--Trost2022 G
NKAIN2     4-0075-003chr6:
124911684-124911684
GTintronicDe novo--Trost2022 G
NKAIN2     2-0223-003chr6:
124911684-124911684
GTintronicDe novo--Trost2022 G
NKAIN2     2-1377-003chr6:
124911684-124911684
GTintronicDe novo--Trost2022 G
NKAIN2     MSSNG00367-004chr6:
125013788-125013788
CAintronicDe novo--Trost2022 G
NKAIN2     7-0397-003chr6:
125015097-125015097
ATintronicDe novo--Trost2022 G
NKAIN2     1-0490-003chr6:
125132507-125132507
AGintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     2-1731-003chr6:
124859656-124859656
TCintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     3-0736-000chr6:
124987382-124987382
ACintronicDe novo--Trost2022 G
NKAIN2     MT_188.3chr6:
124989418-124989418
CGintronicDe novo--Trost2022 G
NKAIN2     A28chr6:
125016406-125016406
TCintronicDe novo--Wu2018 G
NKAIN2     1-1196-003chr6:
124980238-124980239
CACintronicDe novo--Trost2022 G
NKAIN2     AU4263304chr6:
124770812-124770812
AGintronicDe novo--Yuen2017 G
NKAIN2     REACH000431chr6:
124985706-124985706
CTintronicDe novo--Trost2022 G
NKAIN2     1-1215-003chr6:
124969190-124969190
AGintronicDe novo--Trost2022 G
NKAIN2     3-0034-000chr6:
124975528-124975528
CTintronicDe novo--Trost2022 G
NKAIN2     MSSNG00011-004chr6:
125087573-125087573
TTAintronicDe novo--Trost2022 G
NKAIN2     2-0272-004chr6:
124727434-124727434
CCTATAAACTAGintronicDe novo--Yuen2017 G
NKAIN2     2-1066-003chr6:
124626031-124626031
GCintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     MSSNG00385-003chr6:
125088401-125088401
CAintronicDe novo--Trost2022 G
NKAIN2     REACH000101chr6:
125054490-125054490
GAintronicDe novo--Trost2022 G
NKAIN2     1-0182-003chr6:
125086524-125086524
ATintronicDe novo--Trost2022 G
NKAIN2     5-0009-003chr6:
125034087-125034087
AGintronicDe novo--Trost2022 G
NKAIN2     3-0405-000chr6:
125036158-125036158
CGintronicDe novo--Trost2022 G
NKAIN2     3-0800-000chr6:
125015567-125015567
CTintronicDe novo--Trost2022 G
NKAIN2     A31chr6:
125183897-125183898
GAGintergenicDe novo--Wu2018 G
NKAIN2     MSSNG00098-003chr6:
125029706-125029706
CGintronicDe novo--Trost2022 G
NKAIN2     2-1283-004chr6:
124801697-124801697
CAintronicDe novo--Yuen2017 G
NKAIN2     AU3635301chr6:
124720918-124720918
GAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     2-1456-003chr6:
124798044-124798047
TACATintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     AU4067301chr6:
124371237-124371237
AGintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     AU2320301chr6:
125128045-125128045
TCintronicDe novo--Trost2022 G
NKAIN2     1-0299-003chr6:
124746954-124746954
GCintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     MSSNG00397-003chr6:
125131687-125131687
ACintronicDe novo--Trost2022 G
NKAIN2     1-0393-003chr6:
124955632-124955632
CGintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     AU1725306 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
NKAIN2     AU2951303chr6:
124784108-124784108
CTintronicDe novo--Yuen2017 G
NKAIN2     1-0699-003chr6:
124976997-124976997
CTintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     1-0404-003chr6:
125029479-125029479
TCintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     1-0486-003chr6:
124891180-124891180
GAintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     1-0025-004chr6:
124588750-124588750
CTintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     12574.p1chr6:
125121807-125121807
TCintronicDe novo--Wilfert2021 G
NKAIN2     7-0255-003chr6:
124249166-124249166
CTintronicDe novo--Trost2022 G
Yuen2017 G
NKAIN2     2-1461-003chr6:
125179316-125179316
ACintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More