or
or
Exact

Results for "SLC8A1"

Variant Events: 99

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SLC8A1     7-0059-003chr2:
42000713-42000713
CGintergenicDe novo--Yuen2017 G
SLC8A1     1-0336-003chr2:
40684153-40684153
CAintronicDe novo--Yuen2017 G
SLC8A1     1-0640-003chr2:
41707934-41707934
TCintergenicDe novo--Yuen2017 G
SLC8A1     2-1594-003chr2:
40939935-40939935
GTintergenicDe novo--Yuen2017 G
SLC8A1     1-0483-003chr2:
41496083-41496083
TTTAAACintergenicDe novo--Yuen2016 G
SLC8A1     AU4197301chr2:
40759931-40759931
GAintergenicDe novo--Yuen2017 G
SLC8A1     AU065304chr2:
40945091-40945091
AGintergenicDe novo--Yuen2017 G
SLC8A1     1-0487-003chr2:
40745334-40745338
ATTTCAintergenicDe novo--Yuen2016 G
SLC8A1     2-1356-003chr2:
40744890-40744890
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
SLC8A1     AU2569303chr2:
40855175-40855175
AGintergenicDe novo--Yuen2017 G
SLC8A1     1-0763-003chr2:
41883510-41883510
ACintergenicDe novo--Yuen2017 G
SLC8A1     AU3811305chr2:
41968607-41968607
AGintergenicDe novo--Yuen2017 G
SLC8A1     1-0354-006chr2:
40813801-40813804
TTTGTintergenicDe novo--Yuen2017 G
SLC8A1     11464.p1chr2:
41213121-41213122
CTTCintergenicMaternal--Wilfert2021 G
SLC8A1     1-0043-003chr2:
41391988-41391988
GAintergenicDe novo--Yuen2017 G
SLC8A1     5-0110-003chr2:
40687586-40687586
CTintronicDe novo--Yuen2017 G
SLC8A1     AU4426303chr2:
41731285-41731285
AGintergenicDe novo--Yuen2017 G
SLC8A1     AU4356302chr2:
41111671-41111671
CAintergenicDe novo--Yuen2017 G
SLC8A1     2-1336-004chr2:
41675397-41675397
GTintergenicDe novo--Yuen2017 G
SLC8A1     AU2975301chr2:
40667841-40667841
GAintronicDe novo--Yuen2017 G
SLC8A1     3-0456-000Bchr2:
40957539-40957539
GTintergenicDe novo--Yuen2017 G
SLC8A1     1-0569-003chr2:
41213627-41213627
CGintergenicDe novo--Yuen2017 G
SLC8A1     AU075210chr2:
40492856-40492856
TCintronicDe novo--Yuen2017 G
SLC8A1     7-0127-003chr2:
41373808-41373808
GTintergenicDe novo--Yuen2017 G
SLC8A1     1-0604-003chr2:
40765954-40765971
GATATATATATATATATAGATATATATATATATATATAintergenicDe novo--Yuen2017 G
SLC8A1     AU3636302chr2:
41692022-41692022
GCintergenicDe novo--Yuen2017 G
SLC8A1     AU3636302chr2:
41710267-41710267
GAintergenicDe novo--Yuen2017 G
SLC8A1     7-0148-003chr2:
41319122-41319122
ACintergenicDe novo--Yuen2017 G
SLC8A1     Bruno2021:XVIIchr2:
40392055-40392055
CTexonicDe novononsynonymous SNVNM_001112801
NM_001112802
NM_001112800
NM_001252624
NM_021097
c.G2069A
c.G2000A
c.G2093A
c.G2084A
c.G2108A
p.R690H
p.R667H
p.R698H
p.R695H
p.R703H
19.874.125E-5Bruno2021 E
SLC8A1     1-0509-003chr2:
41314535-41314535
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
SLC8A1     2-1368-003chr2:
41447546-41447562
TTGTGTGTGTGTGTGTGTTGTGTGTGTGTGTGintergenicDe novo--Yuen2017 G
SLC8A1     2-1461-003chr2:
41770167-41770167
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
SLC8A1     AU0452304chr2:
40969232-40969232
AGintergenicDe novo--Yuen2017 G
SLC8A1     AU1223303chr2:
41949004-41949004
TCintergenicDe novo--Yuen2017 G
SLC8A1     1-0906-003chr2:
41622942-41622942
GAintergenicDe novo--Yuen2017 G
SLC8A1     AU4015302chr2:
41743900-41743900
AGintergenicDe novo--Yuen2017 G
SLC8A1     2-1722-003chr2:
41964994-41964994
CTintergenicDe novo--Yuen2017 G
SLC8A1     2-1627-003chr2:
41074148-41074148
TCintergenicDe novo--Yuen2017 G
SLC8A1     AU061003chr2:
41693216-41693216
CTintergenicDe novo--Yuen2017 G
SLC8A1     2-0102-004chr2:
41815531-41815531
CAintergenicDe novo--Yuen2017 G
SLC8A1     2-0102-004chr2:
41802073-41802073
AGintergenicDe novo--Yuen2017 G
SLC8A1     AU3809302chr2:
41528879-41528879
GCintergenicDe novo--Yuen2017 G
SLC8A1     1-0898-003chr2:
40680444-40680444
GTintronicDe novo--Yuen2017 G
SLC8A1     5-0074-003chr2:
40721592-40721592
CTintronicDe novo--Yuen2017 G
SLC8A1     2-1093-005chr2:
41360290-41360290
GAintergenicDe novo--Yuen2017 G
SLC8A1     2-1093-005chr2:
41357852-41357852
GCintergenicDe novo--Yuen2017 G
SLC8A1     AU3874301chr2:
41700813-41700813
GAintergenicDe novo--Yuen2017 G
SLC8A1     2-1480-003chr2:
41630905-41630905
AGintergenicDe novo--Yuen2017 G
SLC8A1     2-1244-003chr2:
41169244-41169244
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
SLC8A1     3-0111-000chr2:
41420610-41420610
CGintergenicDe novo--Yuen2016 G
SLC8A1     2-1362-004chr2:
41674118-41674118
AGintergenicDe novo--Yuen2017 G
SLC8A1     2-1480-003chr2:
41630909-41630909
AGintergenicDe novo--Yuen2017 G
SLC8A1     2-1146-003chr2:
40561632-40561632
ATintronicDe novo--Yuen2017 G
SLC8A1     AU4233301chr2:
40784221-40784221
CTintergenicDe novo--Yuen2017 G
SLC8A1     AU2433302chr2:
41798997-41798997
GTintergenicDe novo--Yuen2017 G
SLC8A1     SP0109409chr2:
40656755-40656755
CAexonicDe novononsynonymous SNVNM_001112800
NM_001112801
NM_001252624
NM_021097
NM_001112802
c.G666T
c.G666T
c.G666T
c.G666T
c.G666T
p.L222F
p.L222F
p.L222F
p.L222F
p.L222F
14.14-Fu2022 E
SLC8A1     SP0059004chr2:
40392102-40392102
TCexonicDe novosynonymous SNVNM_001112801
NM_001112802
NM_001112800
NM_001252624
NM_021097
c.A2022G
c.A1953G
c.A2046G
c.A2037G
c.A2061G
p.P674P
p.P651P
p.P682P
p.P679P
p.P687P
--Fu2022 E
SLC8A1     2-0318-004chr2:
41041848-41041848
GTintergenicDe novo--Yuen2017 G
SLC8A1     AU4235301chr2:
40908757-40908757
TCintergenicDe novo--Yuen2017 G
SLC8A1     AU2433302chr2:
41798305-41798305
GTintergenicDe novo--Yuen2017 G
SLC8A1     AU3912303chr2:
40737037-40737037
GAintronicDe novo--Yuen2017 G
SLC8A1     1-0585-003chr2:
41775798-41775798
TCintergenicDe novo--Yuen2017 G
SLC8A1     1-0973-003chr2:
41867181-41867181
ACintergenicDe novo--Yuen2017 G
SLC8A1     12529.p1chr2:
41922292-41922292
TCintergenicDe novo--Turner2016 G
SLC8A1     3-0391-000chr2:
40823502-40823502
TGintergenicDe novo--Yuen2017 G
SLC8A1     AU3839303chr2:
40673656-40673656
TCintronicDe novo--Yuen2017 G
SLC8A1     1-0294-003chr2:
41544484-41544484
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
SLC8A1     1-0051-005chr2:
41078321-41078321
GCintergenicDe novo--Yuen2017 G
SLC8A1     2-1605-004chr2:
41341237-41341237
TAintergenicDe novo--Yuen2017 G
SLC8A1     7-0128-003chr2:
41468907-41468907
CTintergenicDe novo--Yuen2017 G
SLC8A1     1-0404-003chr2:
41820945-41820958
ACTCTCTCTCTCTCACTCTCTCTCTCintergenicDe novo--Yuen2017 G
SLC8A1     AU2140305chr2:
40898672-40898672
TCintergenicDe novo--Yuen2017 G
SLC8A1     AU2140305chr2:
41291537-41291537
CGintergenicDe novo--Yuen2017 G
SLC8A1     AU2140305chr2:
41297334-41297334
TCintergenicDe novo--Yuen2017 G
SLC8A1     AU4159302chr2:
41798196-41798196
TCintergenicDe novo--Yuen2017 G
SLC8A1     3-0216-000chr2:
41130177-41130177
ATintergenicDe novo--Yuen2017 G
SLC8A1     63-343chr2:
41448454-41448454
CGintergenicDe novo--Michaelson2012 G
SLC8A1     AU3760301chr2:
41495876-41495876
GAintergenicDe novo--Yuen2017 G
SLC8A1     1-0345-003chr2:
42043104-42043104
TCintergenicDe novo--Yuen2017 G
SLC8A1     AU038203chr2:
42094259-42094259
TGintergenicDe novo--Yuen2017 G
SLC8A1     7-0024-005chr2:
41631879-41631879
GAintergenicDe novo--Yuen2017 G
SLC8A1     AU039304chr2:
42046326-42046326
GAintergenicDe novo--Yuen2017 G
SLC8A1     1-0278-003chr2:
41924896-41924896
CTintergenicDe novo--Yuen2016 G
SLC8A1     1-0290-003chr2:
41990652-41990653
AGAintergenicDe novo--Yuen2017 G
SLC8A1     1-0196-005chr2:
41659877-41659877
GCintergenicDe novo--Yuen2017 G
SLC8A1     1-0487-003chr2:
41567451-41567451
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
SLC8A1     AU2129301 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
SLC8A1     AU3787302chr2:
40796444-40796444
GCintergenicDe novo--Yuen2017 G
SLC8A1     3-0456-000chr2:
40957539-40957539
GTintergenicDe novo--Yuen2017 G
SLC8A1     7-0123-003chr2:
41663594-41663594
GAintergenicDe novo--Yuen2017 G
SLC8A1     1-0041-003chr2:
41731573-41731573
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
SLC8A1     AU2117302chr2:
41573841-41573841
GTintergenicDe novo--Yuen2017 G
SLC8A1     A1chr2:
42095575-42095575
GAintergenicDe novo--Wu2018 G
SLC8A1     7-0192-003chr2:
41006073-41006073
CTintergenicDe novo--Yuen2017 G
SLC8A1     AU4264302chr2:
41735104-41735104
AGintergenicDe novo--Yuen2017 G
SLC8A1     1-0358-003chr2:
41418027-41418027
GAintergenicDe novo--Yuen2017 G
SLC8A1     AU2029301chr2:
41644558-41644559
GCGintergenicDe novo--Yuen2017 G
SLC8A1     AU4150301chr2:
40978141-40978147
AATTATTAATTintergenicDe novo--Yuen2017 G
SLC8A1     AU0780301chr2:
41348389-41348389
CAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More