or
or
Exact

Results for "NRXN3"

Variant Events: 122

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NRXN3     AU079605chr14:
79474073-79474073
CTintronicDe novo--Yuen2017 G
NRXN3     3-0432-000chr14:
80139413-80139413
TCintronicDe novo--Yuen2016 G
Yuen2017 G
NRXN3     11729.p1chr14:
79434627-79434627
GAexonicMosaic Mat.nonsynonymous SNVNM_004796c.G1961Ap.R654H36.03.295E-5Dou2017 E
NRXN3     2-0289-003chr14:
80229748-80229748
AACintronicDe novo--Yuen2017 G
NRXN3     14642.p1chr14:
80247386-80247386
TAintronicDe novo--Turner2016 G
NRXN3     2-1505-003chr14:
80476608-80476608
GAintergenicDe novo--Yuen2017 G
NRXN3     AU2793302chr14:
80214272-80214272
GAintronicDe novo--Yuen2017 G
NRXN3     7-0080-003chr14:
79707931-79707931
CTintronicDe novo--Yuen2017 G
NRXN3     12529.p1chr14:
79589592-79589592
AGintronicDe novo--Turner2016 G
NRXN3     12498.p1chr14:
79720555-79720555
CTintronicDe novo--Turner2016 G
NRXN3     AU2950302chr14:
80344544-80344544
CGintergenicDe novo--Yuen2017 G
NRXN3     AU3617302chr14:
80222935-80222939
GCCCCGCCCintronicDe novo--Yuen2017 G
NRXN3     2-1107-003chr14:
78944239-78944252
TCACACACACACACTCACACACACACintronicDe novo--Yuen2017 G
NRXN3     AU1995302chr14:
79722870-79722870
CTintronicDe novo--Yuen2017 G
NRXN3     CC1132.201chr14:
79433557-79433557
AGexonicDe novononsynonymous SNVNM_004796c.A1665Gp.I555M16.71-Satterstrom2020 E
NRXN3     1-0092-004chr14:
79763171-79763171
TTAAAintronicDe novo--Yuen2017 G
NRXN3     AU1698302chr14:
79796610-79796616
TAAGAAGTAAGintronicDe novo--Yuen2017 G
NRXN3     2-1398-004chr14:
80406660-80406660
GAintergenicDe novo--Yuen2017 G
NRXN3     AU200Achr14:
80158587-80158587
GAexonicDe novononsynonymous SNVNM_001105250c.G673Ap.E225K23.2-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
NRXN3     1-0206-003chr14:
79031255-79031255
AGintronicDe novo--Yuen2017 G
NRXN3     AU3702307chr14:
79791998-79791998
TGintronicDe novo--Yuen2017 G
NRXN3     AU1521301chr14:
79362809-79362809
CTintronicDe novo--Yuen2017 G
NRXN3     1-0300-004chr14:
79398294-79398294
AGintronicDe novo--Yuen2017 G
NRXN3     1-0019-004chr14:
79929590-79929590
AGintronicDe novo--Yuen2017 G
NRXN3     AU3124304chr14:
80217532-80217532
CAintronicDe novo--Yuen2017 G
NRXN3     AU3861302chr14:
79537831-79537831
TAintronicDe novo--Yuen2017 G
NRXN3     3-0456-000chr14:
79179761-79179761
CTintronicDe novo--Yuen2016 G
Yuen2017 G
NRXN3     1-0627-004chr14:
79760984-79760984
CAintronicDe novo--Yuen2017 G
NRXN3     1-0296-003chr14:
79238511-79238511
AGintronicDe novo--Yuen2017 G
NRXN3     2-1185-003chr14:
80213092-80213092
ATintronicDe novo--Yuen2017 G
NRXN3     AU4089302chr14:
79666460-79666460
AGintronicDe novo--Yuen2017 G
NRXN3     A22chr14:
79849995-79849995
CTintronicDe novo--Wu2018 G
NRXN3     1-0265-004chr14:
80489726-80489726
GGTGTATintergenicDe novo--Yuen2017 G
NRXN3     2-0270-004chr14:
78902975-78902975
GAintronicDe novo--Yuen2017 G
NRXN3     2-0215-003chr14:
79871412-79871412
GAintronicDe novo--Yuen2017 G
NRXN3     5-0125-003chr14:
80533025-80533025
TCintergenicDe novo--Yuen2017 G
NRXN3     1-0590-003chr14:
80026314-80026331
TTGTGTGTGTGTGTGTGTTTGTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
NRXN3     AU2863303chr14:
80211019-80211019
ACintronicDe novo--Yuen2017 G
NRXN3     AU2863303chr14:
80500755-80500755
GAintergenicDe novo--Yuen2017 G
NRXN3     AU4015301chr14:
79758049-79758049
AGintronicDe novo--Yuen2017 G
NRXN3     AU2075301chr14:
79174035-79174035
TCintronicDe novo--Yuen2017 G
NRXN3     1-0080-003chr14:
79990384-79990391
CTAAATAACTAAintronicDe novo--Yuen2017 G
NRXN3     5-0138-003chr14:
79281518-79281518
GAintronicDe novo--Yuen2017 G
NRXN3     1-0336-003chr14:
79457379-79457379
GAintronicDe novo--Yuen2017 G
NRXN3     AU2495302chr14:
79161242-79161242
GAintronicDe novo--Yuen2017 G
NRXN3     1-0447-003chr14:
79704891-79704904
TACACACACACACATACACACACACAintronicDe novo--Yuen2017 G
NRXN3     1-0665-003chr14:
79430826-79430826
GAintronicDe novo--Yuen2017 G
NRXN3     1-0138-003chr14:
79603146-79603146
CTintronicDe novo--Yuen2017 G
NRXN3     1-0138-003chr14:
79235713-79235713
CTintronicDe novo--Yuen2017 G
NRXN3     AU2793303chr14:
79034167-79034167
GTintronicDe novo--Yuen2017 G
NRXN3     1-0186-005chr14:
79826330-79826330
GAintronicDe novo--Yuen2017 G
NRXN3     AU062204chr14:
79248413-79248413
CTintronicDe novo--Yuen2017 G
NRXN3     2-0022-005chr14:
79558786-79558786
TCintronicDe novo--Yuen2017 G
NRXN3     3-0456-000Bchr14:
79179761-79179761
CTintronicDe novo--Yuen2017 G
NRXN3     AU3053302chr14:
79761376-79761376
GAintronicDe novo--Yuen2017 G
NRXN3     1-0380-003chr14:
80179109-80179112
ACCTAintronicDe novo--Yuen2017 G
NRXN3     AU3645301chr14:
79464113-79464113
TGintronicDe novo--Yuen2017 G
NRXN3     AU3955303chr14:
79846662-79846662
TGintronicDe novo--Yuen2017 G
NRXN3     iHART1908chr14:
79269981-79269981
AGexonicDe novononsynonymous SNVNM_004796c.A944Gp.Y315C17.58-Ruzzo2019 G
NRXN3     2-0002-005chr14:
79118017-79118017
AGintronicDe novo--Yuen2017 G
NRXN3     2-1143-003chr14:
80235740-80235740
GAintronicDe novo--Yuen2017 G
NRXN3     AU4007302chr14:
79797011-79797011
CTintronicDe novo--Yuen2017 G
NRXN3     AU3263302chr14:
79472793-79472793
GAintronicDe novo--Yuen2017 G
NRXN3     1-0560-003chr14:
79427866-79427866
AGintronicDe novo--Yuen2017 G
NRXN3     2-1399-003chr14:
79191911-79191911
CTintronicDe novo--Yuen2017 G
NRXN3     AU4145303chr14:
79505122-79505122
GAintronicDe novo--Yuen2017 G
NRXN3     AU072005chr14:
80320536-80320536
AGintronicDe novo--Yuen2017 G
NRXN3     1-0148-005chr14:
79123837-79123837
CAintronicDe novo--Yuen2017 G
NRXN3     1-0458-005chr14:
79545972-79545972
TAintronicDe novo--Yuen2017 G
NRXN3     AU3782303chr14:
79714631-79714631
CAintronicDe novo--Yuen2017 G
NRXN3     1-0292-005chr14:
78999815-78999815
GTintronicDe novo--Yuen2017 G
NRXN3     2-0135-004chr14:
80121936-80121936
ATintronicDe novo--Yuen2017 G
NRXN3     1-0224-004chr14:
79586842-79586842
ACintronicDe novo--Yuen2017 G
NRXN3     2-0214-003chr14:
79070182-79070182
ATintronicDe novo--Yuen2017 G
NRXN3     AU3175303chr14:
80267807-80267815
TTTGATTGATTTGAintronicDe novo--Yuen2017 G
NRXN3     1-0755-003chr14:
78915094-78915094
GAintronicDe novo--Yuen2017 G
NRXN3     2-1206-003chr14:
79943136-79943136
TGintronicDe novo--Yuen2017 G
NRXN3     AU4176302chr14:
79018184-79018185
AGAintronicDe novo--Yuen2017 G
NRXN3     2-0299-003chr14:
78951661-78951661
CGintronicDe novo--Yuen2017 G
NRXN3     5-0018-003chr14:
80356044-80356044
CTintergenicDe novo--Yuen2017 G
NRXN3     1-0863-003chr14:
79408867-79408867
AGintronicDe novo--Yuen2017 G
NRXN3     615-05-104639chr14:
80158652-80158652
CTintronicDe novo--Satterstrom2020 E
NRXN3     1-0403-004chr14:
79895973-79895973
GAintronicDe novo--Yuen2017 G
NRXN3     1-0336-004chr14:
80200977-80200977
GGTATCintronicDe novo--Yuen2017 G
NRXN3     2-1268-003chr14:
79616842-79616842
CTintronicDe novo--Yuen2016 G
Yuen2017 G
NRXN3     2-1510-003chr14:
78924069-78924069
TCintronicDe novo--Yuen2017 G
NRXN3     AU2525302chr14:
80402105-80402105
CGintergenicDe novo--Yuen2017 G
NRXN3     1-0246-004chr14:
79231387-79231387
AGintronicDe novo--Yuen2017 G
NRXN3     2-1254-003chr14:
80078301-80078301
GAintronicDe novo--Yuen2016 G
Yuen2017 G
NRXN3     1-0190-003chr14:
80004933-80004933
GCintronicDe novo--Yuen2017 G
NRXN3     AU4286302chr14:
80101501-80101501
CGintronicDe novo--Yuen2017 G
NRXN3     1-0139-005chr14:
80540505-80540505
TGintergenicDe novo--Yuen2017 G
NRXN3     1-0059-003chr14:
79658772-79658772
AGintronicDe novo--Yuen2017 G
NRXN3     5-0054-003chr14:
79455811-79455811
AGintronicDe novo--Yuen2017 G
NRXN3     AU3875301chr14:
79074154-79074154
CTintronicDe novo--Yuen2017 G
NRXN3     2-1709-003chr14:
79847446-79847446
AGintronicDe novo--Yuen2017 G
NRXN3     AU4344301chr14:
80323811-80323811
TCintronicDe novo--Yuen2017 G
NRXN3     2-1302-003chr14:
80193643-80193643
CTintronicDe novo--Yuen2017 G
NRXN3     1-0092-003chr14:
80432632-80432632
GAintergenicDe novo--Yuen2017 G
NRXN3     AU031204chr14:
79739147-79739147
TAintronicDe novo--Yuen2017 G
NRXN3     AU2248301chr14:
80238710-80238710
CGintronicDe novo--Yuen2017 G
NRXN3     AU4468301chr14:
79710900-79710900
CTintronicDe novo--Yuen2017 G
NRXN3     1-0257-003chr14:
79111550-79111550
AGUTR5De novo23.0-Yuen2017 G
NRXN3     1-0385-003chr14:
79316489-79316503
CAGAGAGAGAGAGAGCAGAGAGAGAGAGintronicDe novo--Yuen2017 G
NRXN3     13692.p1chr14:
80028720-80028720
TCintronicDe novo--Wilfert2021 G
NRXN3     2-0307-004chr14:
79314490-79314490
GTintronicDe novo--Yuen2017 G
NRXN3     AU3912303chr14:
79383947-79383947
TCintronicDe novo--Yuen2017 G
NRXN3     AU1448301chr14:
79970807-79970807
GAintronicDe novo--Yuen2017 G
NRXN3     2-1239-003chr14:
79448652-79448652
CAintronicDe novo--Yuen2017 G
NRXN3     AU1795301chr14:
79935375-79935375
CTintronicDe novo--Yuen2017 G
NRXN3     AU2000305chr14:
78989326-78989326
TGintronicDe novo--Yuen2017 G
NRXN3     AU2293301chr14:
79942598-79942598
CTintronicDe novo--Yuen2017 G
NRXN3     AU3808304chr14:
79794123-79794123
GAintronicDe novo--Yuen2017 G
NRXN3     5-0004-003chr14:
79115893-79115893
CTintronicDe novo--Yuen2017 G
NRXN3     1-0032-003chr14:
80095504-80095504
AAAATTTGTATCintronicDe novo--Yuen2017 G
NRXN3     AU3889305chr14:
78951731-78951731
GAintronicDe novo--Yuen2017 G
NRXN3     1-0973-003chr14:
80158970-80158973
AGGGAGGintronicDe novo--Yuen2017 G
NRXN3     AU1894304chr14:
80647066-80647066
TCintergenicDe novo--Yuen2017 G
NRXN3     1-0295-003chr14:
80494933-80494933
CTintergenicDe novo--Yuen2017 G
NRXN3     1-0299-003chr14:
79813582-79813582
AGintronicDe novo--Yuen2017 G
NRXN3     5-0129-003chr14:
79179812-79179812
AGintronicDe novo--Yuen2017 G
NRXN3     1-0393-003chr14:
79781047-79781047
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More