or
or
Exact

Results for "NIN"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NIN     1-0112-004chr14:
51237715-51237715
GAintronicDe novo-2.503E-5Yuen2017 G
NIN     F9958-1chr14:
51228624-51228624
CGexonicDe novononsynonymous SNVNM_016350
NM_020921
NM_182944
NM_182946
c.G1780C
c.G1780C
c.G1780C
c.G1780C
p.G594R
p.G594R
p.G594R
p.G594R
15.96-Satterstrom2020 E
NIN     1-0978-003chr14:
51210363-51210363
GAintronicDe novo--Yuen2017 G
NIN     Li2017:19563chr14:
51238156-51238156
TCexonicUnknownnonsynonymous SNVNM_016350
NM_020921
NM_182944
NM_182946
c.A1012G
c.A1012G
c.A1012G
c.A1012G
p.N338D
p.N338D
p.N338D
p.N338D
25.8-Li2017 T
NIN     1-0539-003chr14:
51317843-51317843
TCintergenicDe novo--Yuen2017 G
NIN     2-1391-003chr14:
51337747-51337747
GGAintergenicDe novo--Yuen2017 G
NIN     1-0559-003chr14:
51287230-51287230
GAintronicDe novo--Yuen2017 G
NIN     AU4306302chr14:
51328268-51328268
CTintergenicDe novo--Yuen2017 G
NIN     2-1154-003chr14:
51195671-51195671
GTintronicDe novo--Yuen2016 G
Yuen2017 G
NIN     2-1358-003chr14:
51307358-51307358
GAintergenicDe novo--Yuen2017 G
NIN     iHART2474chr14:
51224702-51224702
GAexonicPaternalstopgainNM_020921
NM_182944
NM_182946
c.C3046T
c.C3046T
c.C3046T
p.Q1016X
p.Q1016X
p.Q1016X
38.0-Ruzzo2019 G
NIN     09C96267chr14:
51211129-51211129
GGTAAGTACAAAGGGGTATTTCTGAintronicDe novo--Satterstrom2020 E
NIN     Li2017:20609chr14:
51196293-51196293
TTGexonicUnknownframeshift insertionNM_016350
NM_020921
NM_182944
NM_182946
c.3886dupC
c.6025dupC
c.6025dupC
c.6025dupC
p.Q1296fs
p.Q2009fs
p.Q2009fs
p.Q2009fs
--Li2017 T
NIN     iHART2473chr14:
51224702-51224702
GAexonicPaternalstopgainNM_020921
NM_182944
NM_182946
c.C3046T
c.C3046T
c.C3046T
p.Q1016X
p.Q1016X
p.Q1016X
38.0-Ruzzo2019 G
NIN     13183.p1chr14:
51223326-51223328
AATAexonicDe novoframeshift deletionNM_020921
NM_182944
NM_182946
c.4420_4421del
c.4420_4421del
c.4420_4421del
p.I1474fs
p.I1474fs
p.I1474fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
NIN     14391.p1chr14:
51245480-51245480
TCintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More