or
or
Exact

Results for "SLC35F4"

Variant Events: 25

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SLC35F4     1-0756-005chr14:
58340300-58340300
CTintergenicDe novo--Yuen2017 G
SLC35F4     7-0104-003chr14:
58436313-58436313
GAintergenicDe novo--Yuen2017 G
SLC35F4     iHART3103chr14:
58038738-58038738
CAsplicingMaternalsplicing25.3-Ruzzo2019 G
SLC35F4     2-1186-003chr14:
58168221-58168221
GAintronicDe novo--Yuen2016 G
Yuen2017 G
SLC35F4     iHART3107chr14:
58038738-58038738
CAsplicingMaternalsplicing25.3-Ruzzo2019 G
SLC35F4     1-0508-003chr14:
58327228-58327228
CTintronicDe novo--Yuen2017 G
SLC35F4     7-0103-003chr14:
58354523-58354523
CTintergenicDe novo--Yuen2017 G
SLC35F4     2-1502-003chr14:
58176346-58176346
TAintronicDe novo--Yuen2017 G
SLC35F4     1-0834-003chr14:
58196120-58196120
CTintronicDe novo--Yuen2017 G
SLC35F4     2-1725-003chr14:
58029701-58029701
GAdownstreamDe novo--Yuen2017 G
SLC35F4     1-0203-004chr14:
58243037-58243037
AGintronicDe novo--Yuen2017 G
SLC35F4     1-0447-003chr14:
58244492-58244511
CATAATAATAATAATAATAACATAATAATAATAATAAintronicDe novo--Yuen2017 G
SLC35F4     AU003403chr14:
58390070-58390070
CTintergenicDe novo--Yuen2017 G
SLC35F4     1-0214-003chr14:
58234278-58234278
TCintronicDe novo--Yuen2017 G
SLC35F4     2-1335-004chr14:
58298590-58298590
TGintronicDe novo--Yuen2017 G
SLC35F4     1-0354-006chr14:
58404622-58404622
TCintergenicDe novo--Yuen2017 G
SLC35F4     1-0403-003chr14:
58338654-58338654
GAintergenicDe novo--Yuen2017 G
SLC35F4     1-0403-003chr14:
58145501-58145501
CAintronicDe novo--Yuen2017 G
SLC35F4     AU3371303chr14:
58095961-58095961
GCintronicDe novo--Yuen2017 G
SLC35F4     1-0591-003chr14:
58175370-58175370
GAintronicDe novo--Yuen2017 G
SLC35F4     2-1702-004chr14:
58041614-58041617
GTTCGintronicDe novo--Yuen2017 G
SLC35F4     AU4269301chr14:
58359416-58359416
GAintergenicDe novo--Yuen2017 G
SLC35F4     1-0336-004chr14:
58192395-58192395
AAACAGintronicDe novo--Yuen2017 G
SLC35F4     1-0138-004chr14:
58354026-58354026
GAintergenicDe novo--Yuen2017 G
SLC35F4     1-0381-003chr14:
58372404-58372404
ACintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More