or
or
Exact

Results for "MIPOL1"

Variant Events: 21

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MIPOL1     2-1305-003chr14:
37798045-37798045
GAintronicDe novo--Yuen2016 G
MIPOL1     AU008505chr14:
37967058-37967062
GACTAGAintronicDe novo--Yuen2017 G
MIPOL1     AU066404chr14:
37927568-37927568
TCintronicDe novo--Yuen2017 G
MIPOL1     AU4239301chr14:
38000695-38000695
TCintronicDe novo--Yuen2017 G
MIPOL1     7-0001-003chr14:
37727515-37727515
AGintronicDe novo--Yuen2017 G
MIPOL1     2-1460-003chr14:
37779284-37779284
CGintronicDe novo--Yuen2017 G
MIPOL1     14153.p1chr14:
37962226-37962226
ATintronicDe novo--Turner2016 G
MIPOL1     AU2123301chr14:
37976440-37976440
CAintronicDe novo--Yuen2017 G
MIPOL1     2-1460-003chr14:
37781992-37781992
AGintronicDe novo--Yuen2017 G
MIPOL1     5-0050-003chr14:
37918174-37918174
ACintronicDe novo--Yuen2017 G
MIPOL1     1-0604-003chr14:
37690824-37690838
AAGAGAGAGAGAGAGAAGAGAGAGAGAGintronicDe novo--Yuen2017 G
MIPOL1     2-1514-003chr14:
37987380-37987380
CGintronicDe novo--Yuen2017 G
MIPOL1     13516.p1chr14:
37777232-37777232
AGintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
MIPOL1     1-0572-003chr14:
37690824-37690838
AAGAGAGAGAGAGAGAAGAGAGAGAGAGintronicDe novo--Yuen2017 G
MIPOL1     1-0683-003chr14:
37694693-37694693
ACintronicDe novo--Yuen2017 G
MIPOL1     iHART2155chr14:
37838804-37838804
AAAAACAATCAAGAACGTGCTexonicPaternalframeshift insertionNM_138731
NM_001195296
NM_001195297
c.911_912insAAACAATCAAGAACGTGCT
c.911_912insAAACAATCAAGAACGTGCT
c.911_912insAAACAATCAAGAACGTGCT
p.E304fs
p.E304fs
p.E304fs
-1.657E-5Ruzzo2019 G
MIPOL1     2-0307-003chr14:
37891058-37891058
AGintronicDe novo--Yuen2017 G
MIPOL1     5-0055-003chr14:
37689104-37689104
TTTGAGTAATATCTTTGAGTAATGTAGTTTGAGTAintronicDe novo--Yuen2017 G
MIPOL1     iHART2154chr14:
37838804-37838804
AAAAACAATCAAGAACGTGCTexonicPaternalframeshift insertionNM_138731
NM_001195296
NM_001195297
c.911_912insAAACAATCAAGAACGTGCT
c.911_912insAAACAATCAAGAACGTGCT
c.911_912insAAACAATCAAGAACGTGCT
p.E304fs
p.E304fs
p.E304fs
-1.657E-5Ruzzo2019 G
MIPOL1     1-0489-003chr14:
37665319-37665336
CAGAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
MIPOL1     AU2165301chr14:
37988469-37988469
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More