or
or
Exact

Results for "OLFM2"

Variant Events: 8

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
OLFM2     1-0489-003chr19:
10015343-10015343
CGintronicDe novo--Yuen2016 G
OLFM2     AU071804chr19:
10047000-10047016
ACAGCAGCAGCAGCAGCACAGCAGCAGCAGCexonicDe novononframeshift deletionNM_058164c.27_29delp.9_10del--Yuen2017 G
OLFM2     AU079605chr19:
9975297-9975297
AGintronicDe novo--Yuen2017 G
OLFM2     2-1725-003chr19:
10023451-10023451
GAintronicDe novo--Yuen2017 G
OLFM2     3-0428-000chr19:
10015862-10015862
GAintronicDe novo--Yuen2017 G
OLFM2     2-0215-003chr19:
9970153-9970153
CTintronicDe novo--Yuen2017 G
OLFM2     2-0215-003chr19:
9969353-9969353
CTintronicDe novo--Yuen2017 G
OLFM2     2007-24164chr19:
9971445-9971445
CTexonicnonsynonymous SNVNM_001304347
NM_058164
c.G161A
c.G89A
p.G54D
p.G30D
28.5-Callaghan2019 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More