or
or
Exact

Results for "DSCAML1"

Variant Events: 27

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DSCAML1     1-0346-004chr11:
117312915-117312915
AATATGintronicDe novo--Yuen2017 G
DSCAML1     12759.p1chr11:
117374523-117374523
TCintronicDe novo--Satterstrom2020 E
DSCAML1     1-0508-003chr11:
117574921-117574940
GATAATAATAATAATAATAAGATAATAATAATAATAAintronicDe novo--Yuen2017 G
DSCAML1     SSC12226chr11:
117309629-117309629
TCexonicDe novosynonymous SNVNM_020693c.A4395Gp.P1465P--Lim2017 E
DSCAML1     SSC08351chr11:
117301436-117301436
AGsplicingDe novosplicing24.1-Lim2017 E
DSCAML1     2-1466-003chr11:
117298256-117298256
GAdownstreamDe novo--Yuen2016 G
Yuen2017 G
DSCAML1     1-0402-003chr11:
117495781-117495781
GAintronicDe novo--Yuen2017 G
DSCAML1     2-1357-003chr11:
117607052-117607052
AGintronicDe novo--Yuen2017 G
DSCAML1     AU1635302chr11:
117411137-117411137
TCintronicDe novo--Yuen2017 G
DSCAML1     AU4079302chr11:
117328776-117328776
TCintronicDe novo--Yuen2017 G
DSCAML1     AU4176302chr11:
117673126-117673126
CTintergenicDe novo--Yuen2017 G
DSCAML1     388-05-103530chr11:
117332319-117332319
GCintronicDe novo--Satterstrom2020 E
DSCAML1     TAS_F0273Ychr11:
117342590-117342590
CTexonicDe novononsynonymous SNVNM_020693c.G3127Ap.E1043K24.1-Satterstrom2020 E
DSCAML1     1-0201-004chr11:
117343756-117343756
CTintronicDe novo--Yuen2017 G
DSCAML1     2-0142-004chr11:
117357000-117357000
TGintronicDe novo--Yuen2017 G
DSCAML1     1-0564-003chr11:
117378906-117378906
CTintronicDe novo--Yuen2017 G
DSCAML1     2-1230-003chr11:
117451867-117451867
CTintronicDe novo--Yuen2016 G
Yuen2017 G
DSCAML1     AU069603chr11:
117335503-117335503
CAintronicDe novo--Yuen2017 G
DSCAML1     AU3885304chr11:
117687730-117687730
CGintergenicDe novo--Yuen2017 G
DSCAML1     1792-23269chr11:
117308080-117308080
GCexonicInheritednonsynonymous SNVNM_020693c.C4658Gp.S1553C23.4-Callaghan2019 G
DSCAML1     1-0253-005chr11:
117352843-117352843
GTexonicDe novosynonymous SNVNM_020693c.C2574Ap.T858T--Yuen2017 G
DSCAML1     2-1407-003chr11:
117320444-117320444
GCintronicDe novo--Yuen2016 G
Yuen2017 G
DSCAML1     A3chr11:
117540524-117540524
CTintronicDe novo--Wu2018 G
DSCAML1     12137.p1chr11:
117395497-117395497
CAintronicMosaic-0.2701Dou2017 E
DSCAML1     13582.p1chr11:
117301436-117301436
AGsplicingDe novosplicing24.1-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
DSCAML1     3-0134-000chr11:
117341026-117341027
TCTintronicDe novo--Yuen2017 G
DSCAML1     14687.p1chr11:
117309629-117309629
TCexonicDe novosynonymous SNVNM_020693c.A4395Gp.P1465P--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More