or
or
Exact

Results for "ANKRD17"

Variant Events: 26

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ANKRD17     09C95606chr4:
73957308-73957311
CTGTCexonicDe novononframeshift deletionNM_198889
NM_001286771
NM_032217
c.5281_5283del
c.5695_5697del
c.6034_6036del
p.1761_1761del
p.1899_1899del
p.2012_2012del
--DeRubeis2014 E
Kosmicki2017 E
ANKRD17     DEASD_0332_001chr4:
74026943-74026943
CTexonicDe novononsynonymous SNVNM_001286771
NM_032217
NM_198889
c.G331A
c.G670A
c.G670A
p.A111T
p.A224T
p.A224T
23.9-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
ANKRD17     1-0441-003chr4:
74227425-74227425
CTintergenicDe novo--Yuen2017 G
ANKRD17     AU4315302chr4:
74100253-74100253
GAintronicDe novo--Yuen2017 G
ANKRD17     11583.p1chr4:
73968205-73968205
CTexonicDe novosynonymous SNVNM_198889
NM_001286771
NM_032217
c.G3708A
c.G4122A
c.G4461A
p.K1236K
p.K1374K
p.K1487K
--Iossifov2014 E
Kosmicki2017 E
ANKRD17     13851.p1chr4:
73981598-73981598
TGexonicDe novononsynonymous SNVNM_198889
NM_001286771
NM_032217
c.A3471C
c.A3885C
c.A4224C
p.E1157D
p.E1295D
p.E1408D
21.2-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
ANKRD17     2-1228-003chr4:
74092893-74092893
CTintronicDe novo--Yuen2016 G
Yuen2017 G
ANKRD17     2-0240-004chr4:
74159213-74159213
CGintergenicDe novo--Yuen2017 G
ANKRD17     200675730@1082034174chr4:
73957176-73957176
TTAexonicDe novostopgainNM_198889
NM_001286771
NM_032217
c.5415dupT
c.5829dupT
c.6168dupT
p.R1806_N1807delinsX
p.R1944_N1945delinsX
p.R2057_N2058delinsX
--Satterstrom2020 E
ANKRD17     1-0246-004chr4:
74132284-74132284
TGintergenicDe novo--Yuen2017 G
ANKRD17     AU2162302chr4:
74002061-74002061
CTintronicDe novo--Yuen2017 G
ANKRD17     AU2162302chr4:
74142375-74142375
CTintergenicDe novo--Yuen2017 G
ANKRD17     AU3506303chr4:
73968259-73968259
CAexonicDe novononsynonymous SNVNM_198889
NM_001286771
NM_032217
c.G3654T
c.G4068T
c.G4407T
p.R1218S
p.R1356S
p.R1469S
14.96-Yuen2017 G
ANKRD17     16260-27149chr4:
74007509-74007509
GAexonicInheritednonsynonymous SNVNM_001286771
NM_032217
NM_198889
c.C1942T
c.C2281T
c.C2281T
p.P648S
p.P761S
p.P761S
35.0-Callaghan2019 G
ANKRD17     1-0215-006chr4:
74224673-74224673
GAintergenicDe novo--Yuen2017 G
ANKRD17     DEASD_1063_001chr4:
73957308-73957311
CTGTCexonicDe novononframeshift deletionNM_198889
NM_001286771
NM_032217
c.5281_5283del
c.5695_5697del
c.6034_6036del
p.1761_1761del
p.1899_1899del
p.2012_2012del
--Satterstrom2020 E
ANKRD17     1-0568-003chr4:
74206960-74206960
TCintergenicDe novo--Yuen2017 G
ANKRD17     1-0862-003chr4:
74236620-74236620
CTintergenicDe novo--Yuen2017 G
ANKRD17     2-1116-003chr4:
74254161-74254161
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ANKRD17     1-0530-003chr4:
73983732-73983732
AGintronicDe novo--Yuen2016 G
Yuen2017 G
ANKRD17     2-0006-004chr4:
74136225-74136225
AGintergenicDe novo--Yuen2017 G
ANKRD17     DEASD_1019_001chr4:
73981668-73981668
GCintronicDe novo--Satterstrom2020 E
ANKRD17     A1chr4:
74240229-74240229
GAintergenicDe novo--Wu2018 G
ANKRD17     1-0332-003chr4:
74237179-74237179
AGintergenicDe novo--Yuen2017 G
ANKRD17     2-1373-003chr4:
74022345-74022360
GCTCTCTCTCTCTCTCGCTCTCTCTCTCTCintronicDe novo--Yuen2017 G
ANKRD17     7-0223-003chr4:
74187723-74187723
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More