or
or
Exact

Results for "RAPGEF4"

Variant Events: 25

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RAPGEF4     7-0130-003chr2:
173772150-173772150
GAintronicDe novo--Yuen2017 G
RAPGEF4     1-0874-003chr2:
173728179-173728179
CTintronicDe novo--Yuen2017 G
RAPGEF4     AU201Achr2:
173898693-173898693
GAsplicingDe novosplicing25.6-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
RAPGEF4     AU2139303chr2:
173832154-173832154
GAexonicDe novononsynonymous SNVNM_001282901
NM_001282900
NM_001100397
NM_001282899
NM_007023
c.G326A
c.G473A
c.G554A
c.G527A
c.G986A
p.R109K
p.R158K
p.R185K
p.R176K
p.R329K
21.0-Yuen2017 G
RAPGEF4     NDAR_INVWJ494BME_wes1chr2:
173787028-173787028
CTexonicMosaicsynonymous SNVNM_001100397
NM_001282899
NM_001282900
NM_007023
c.C105T
c.C78T
c.C78T
c.C537T
p.N35N
p.N26N
p.N26N
p.N179N
-3.313E-5Lim2017 E
RAPGEF4     1-0627-004chr2:
173737677-173737677
AGintronicDe novo--Yuen2017 G
RAPGEF4     2-1131-003chr2:
173754414-173754430
GACACACACACACACACGACACACACACACACintronicDe novo--Yuen2017 G
RAPGEF4     SSC09204chr2:
173885400-173885400
AGexonicDe novononsynonymous SNVNM_001282901
NM_001282900
NM_001100397
NM_001282899
NM_007023
c.A1550G
c.A1697G
c.A1778G
c.A1751G
c.A2210G
p.N517S
p.N566S
p.N593S
p.N584S
p.N737S
26.1-Lim2017 E
RAPGEF4     2-1250-003chr2:
173848799-173848799
AGintronicDe novo--Yuen2017 G
RAPGEF4     12224.p1chr2:
173883542-173883542
AGintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
RAPGEF4     13869.p1chr2:
173885400-173885400
AGexonicDe novononsynonymous SNVNM_001282901
NM_001282900
NM_001100397
NM_001282899
NM_007023
c.A1550G
c.A1697G
c.A1778G
c.A1751G
c.A2210G
p.N517S
p.N566S
p.N593S
p.N584S
p.N737S
26.1-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
RAPGEF4     AU3768302chr2:
173817088-173817088
GAintronicDe novo--Yuen2017 G
RAPGEF4     AU060803chr2:
173936420-173936420
AGintergenicDe novo--Yuen2017 G
RAPGEF4     5-0065-003chr2:
173806416-173806416
GCintronicDe novo--Yuen2017 G
RAPGEF4     AU3912302chr2:
173900100-173900100
CAintronicDe novo--Yuen2017 G
RAPGEF4     2-1237-003chr2:
173730359-173730359
CAintronicDe novo--Yuen2017 G
RAPGEF4     5-0109-003chr2:
173710424-173710424
CTintronicDe novo--Yuen2017 G
RAPGEF4     2-0006-003chr2:
173899235-173899235
GAintronicDe novo--Yuen2017 G
RAPGEF4     iHART2809chr2:
173832154-173832154
GAexonicDe novononsynonymous SNVNM_001282901
NM_001282900
NM_001100397
NM_001282899
NM_007023
c.G326A
c.G473A
c.G554A
c.G527A
c.G986A
p.R109K
p.R158K
p.R185K
p.R176K
p.R329K
21.0-Ruzzo2019 G
RAPGEF4     1-0265-004chr2:
173838574-173838574
CTintronicDe novo--Yuen2017 G
RAPGEF4     2-1627-003chr2:
173921723-173921723
GAintergenicDe novo--Yuen2017 G
RAPGEF4     21758-34760chr2:
173787029-173787029
GAsplicingsplicing18.466.625E-5Callaghan2019 G
RAPGEF4     2-1487-003chr2:
173727544-173727545
CACAAintronicDe novo--Yuen2017 G
RAPGEF4     2-1337-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
RAPGEF4     AU1860301chr2:
173908248-173908248
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More