or
or
Exact

Results for "CASZ1"

Variant Events: 52

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CASZ1     M19553chr1:
10713944-10713944
CTexonicUnknownnonsynonymous SNVNM_001079843
NM_017766
c.G2170A
c.G2170A
p.D724N
p.D724N
29.9-Wang2020 T
Wang2020 T
CASZ1     219-2286-0001chr1:
10703326-10703326
CTexonicUnknownnonsynonymous SNVNM_001079843c.G3911Ap.R1304Q36.08.396E-6Wang2020 T
Wang2020 T
CASZ1     Ishay2021:9chr1:
10714021-10714021
CTexonicInheritednonsynonymous SNVNM_001079843
NM_017766
c.G2093A
c.G2093A
p.R698H
p.R698H
35.03.317E-5Ishay2021 E
CASZ1     268844chr1:
10725572-10725572
GAexonicUnknownnonsynonymous SNVNM_001079843
NM_017766
c.C73T
c.C73T
p.R25C
p.R25C
20.93.0E-4Wang2020 T
Wang2020 T
CASZ1     GX0235.p1chr1:
10715750-10715750
CTexonicMaternalnonsynonymous SNVNM_001079843
NM_017766
c.G1621A
c.G1621A
p.G541S
p.G541S
36.0-Wang2020 T
Wang2020 T
CASZ1     M23697chr1:
10705096-10705096
CAexonicUnknownnonsynonymous SNVNM_001079843c.G3746Tp.C1249F26.8-Wang2020 T
Wang2020 T
CASZ1     M23736chr1:
10702937-10702937
CAexonicUnknownnonsynonymous SNVNM_001079843c.G4141Tp.G1381C24.0-Wang2020 T
Wang2020 T
CASZ1     D2N5Cchr1:
10715750-10715750
CTexonicMaternal, Unknownnonsynonymous SNVNM_001079843
NM_017766
c.G1621A
c.G1621A
p.G541S
p.G541S
36.0-Wang2020 T
Wang2020 T
Wang2020 T
Wang2020 T
CASZ1     212-21001-1chr1:
10716788-10716788
GAexonicUnknownnonsynonymous SNVNM_001079843
NM_017766
c.C1415T
c.C1415T
p.S472L
p.S472L
27.8-Wang2020 T
Wang2020 T
CASZ1     421686chr1:
10716770-10716770
CAexonicUnknownnonsynonymous SNVNM_001079843
NM_017766
c.G1433T
c.G1433T
p.G478V
p.G478V
27.9-Wang2020 T
Wang2020 T
CASZ1     7-0035-003chr1:
10824836-10824836
GAintronicDe novo--Yuen2017 G
CASZ1     07C66975chr1:
10700023-10700023
GAexonicUnknownnonsynonymous SNVNM_001079843c.C4256Tp.A1419V35.05.096E-5Wang2020 T
Wang2020 T
CASZ1     109531-100chr1:
10705030-10705030
CGexonicUnknownnonsynonymous SNVNM_001079843c.G3812Cp.R1271P29.2-Wang2020 T
Wang2020 T
CASZ1     Viggiano2022:22.4chr1:
10713547-10713547
GAexonicPaternalnonsynonymous SNVNM_001079843
NM_017766
c.C2567T
c.C2567T
p.P856L
p.P856L
10.731.0E-4Viggiano2022 GT
CASZ1     299375chr1:
10703027-10703027
CTexonicUnknownnonsynonymous SNVNM_001079843c.G4051Ap.D1351N35.05.119E-5Wang2020 T
Wang2020 T
CASZ1     05C51810chr1:
10700014-10700014
CTexonicUnknownnonsynonymous SNVNM_001079843c.G4265Ap.R1422Q34.01.699E-5Wang2020 T
Wang2020 T
Wang2020 T
CASZ1     2-0304-004chr1:
10773767-10773767
CTintronicDe novo--Yuen2017 G
CASZ1     AU2029303chr1:
10699875-10699877
GAAGAAAexonicDe novoframeshift insertionNM_001079843c.4402dupTp.F1468fs--Wang2020 T
Yuen2017 G
CASZ1     214-17039-1chr1:
10699725-10699727
CAGTAGGTexonicUnknownframeshift substitutionNM_001079843c.4552_4554ACCTAN/A--Wang2020 T
Wang2020 T
CASZ1     Viggiano2022:22.3chr1:
10713547-10713547
GAexonicPaternalnonsynonymous SNVNM_001079843
NM_017766
c.C2567T
c.C2567T
p.P856L
p.P856L
10.731.0E-4Viggiano2022 GT
CASZ1     M8U5Kchr1:
10725539-10725539
CTexonicUnknownnonsynonymous SNVNM_001079843
NM_017766
c.G106A
c.G106A
p.A36T
p.A36T
35.01.854E-5Wang2020 T
Wang2020 T
CASZ1     03C16528chr1:
10713896-10713896
CTexonicUnknownnonsynonymous SNVNM_001079843
NM_017766
c.G2218A
c.G2218A
p.A740T
p.A740T
35.03.4E-5Wang2020 T
Wang2020 T
CASZ1     09C84306chr1:
10700014-10700014
CTexonicUnknownnonsynonymous SNVNM_001079843c.G4265Ap.R1422Q34.01.699E-5Wang2020 T
Wang2020 T
CASZ1     80964chr1:
10720575-10720575
CTexonicUnknownnonsynonymous SNVNM_001079843
NM_017766
c.G524A
c.G524A
p.R175Q
p.R175Q
26.89.279E-5Wang2020 T
Wang2020 T
CASZ1     M15013chr1:
10714268-10714268
CTexonicUnknownnonsynonymous SNVNM_001079843
NM_017766
c.G1846A
c.G1846A
p.G616S
p.G616S
33.02.482E-5Wang2020 T
Wang2020 T
CASZ1     2-1268-003chr1:
10756275-10756275
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CASZ1     2-1195-003chr1:
10807124-10807124
AGintronicDe novo--Yuen2016 G
Yuen2017 G
CASZ1     7-0001-003chr1:
10807161-10807165
TCCCCTCCintronicDe novo--Yuen2017 G
CASZ1     AU2029302chr1:
10699875-10699877
GAAGAAAexonicDe novoframeshift insertionNM_001079843c.4402dupTp.F1468fs--Wang2020 T
Yuen2017 G
CASZ1     7-0250-003chr1:
10853773-10853773
TCintronicDe novo--Yuen2017 G
CASZ1     AU3900301chr1:
10853602-10853602
ATintronicDe novo--Yuen2017 G
CASZ1     AU4191302chr1:
10740278-10740278
CAintronicDe novo--Yuen2017 G
CASZ1     7-0255-003chr1:
10760049-10760064
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
CASZ1     AU038203chr1:
10757854-10757854
GAintronicDe novo--Yuen2017 G
CASZ1     AU066818chr1:
10817214-10817214
AGintronicDe novo--Yuen2017 G
CASZ1     2-1508-003chr1:
10947996-10947996
TGintergenicDe novo--Yuen2017 G
CASZ1     12568.p1chr1:
10899923-10899923
GCintergenicDe novo--Turner2016 G
CASZ1     1-0991-003chr1:
10881994-10881994
CTintergenicDe novo--Yuen2017 G
CASZ1     14465.p1chr1:
10798964-10798964
CTintronicDe novo--Wilfert2021 G
CASZ1     11604.p1chr1:
10711096-10711097
CGCexonicDe novoframeshift deletionNM_001079843
NM_017766
c.2717delC
c.2717delC
p.P906fs
p.P906fs
--Wilfert2021 G
CASZ1     1-0041-003chr1:
10737318-10737318
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CASZ1     SF0100556.p1chr1:
10725142-10725142
GCexonicDe novostopgainNM_001079843
NM_017766
c.C503G
c.C503G
p.S168X
p.S168X
36.0-Wang2020 T
CASZ1     SF0144917.p1chr1:
10714537-10714537
CTexonicDe novononsynonymous SNVNM_001079843
NM_017766
c.G1777A
c.G1777A
p.E593K
p.E593K
36.0-Wang2020 T
CASZ1     SF0020416.p1chr1:
10702943-10702943
GAexonicDe novononsynonymous SNVNM_001079843c.C4135Tp.P1379S27.5-Wang2020 T
CASZ1     SF0086394.p1chr1:
10699397-10699398
AGAexonicDe novoframeshift deletionNM_001079843c.4881delCp.G1627fs--Wang2020 T
CASZ1     AU070703chr1:
10922632-10922632
TAintergenicDe novo--Yuen2017 G
CASZ1     HEN0165.p1chr1:
10707999-10707999
CGexonicMaternalnonsynonymous SNVNM_001079843
NM_017766
c.G3356C
c.G3356C
p.W1119S
p.W1119S
29.4-Wang2020 T
Wang2020 T
CASZ1     F8293-1chr1:
10720587-10720587
GCexonicDe novononsynonymous SNVNM_001079843
NM_017766
c.C512G
c.C512G
p.A171G
p.A171G
15.99-Satterstrom2020 E
CASZ1     GX0279.p1chr1:
10720351-10720351
CTexonicMaternalnonsynonymous SNVNM_001079843
NM_017766
c.G748A
c.G748A
p.E250K
p.E250K
33.02.491E-5Wang2020 T
Wang2020 T
CASZ1     GX0526.p1chr1:
10708003-10708003
CTexonicMaternalnonsynonymous SNVNM_001079843
NM_017766
c.G3352A
c.G3352A
p.A1118T
p.A1118T
36.08.438E-6Wang2020 T
Wang2020 T
CASZ1     Y4K7Cchr1:
10699679-10699679
GTexonicUnknownnonsynonymous SNVNM_001079843c.C4600Ap.R1534S33.0-Wang2020 T
Wang2020 T
CASZ1     AU2139305chr1:
10829994-10829994
GCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More