or
or
Exact

Results for "EEF1A2"

Variant Events: 14

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EEF1A2     2-0135-003chr20:
62138602-62138602
TAintergenicDe novo--Yuen2017 G
EEF1A2     Nakajima2014:2chr20:
62126415-62126415
CTexonicDe novononsynonymous SNVNM_001958c.G364Ap.E122K34.0-Nakajima2014 E
EEF1A2     14503.p1chr20:
62120390-62120390
CTexonicDe novononsynonymous SNVNM_001958c.G1145Ap.R382H17.85-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
EEF1A2     03C16619chr20:
62121948-62121948
CTexonicUnknownnonsynonymous SNVNM_001958c.G913Ap.G305S23.38.36E-6Wang2020 T
Wang2020 T
EEF1A2     13529.p1chr20:
62126140-62126140
GAintronicDe novo-4.335E-5Krumm2015 E
EEF1A2     1-0184-003chr20:
62123119-62123145
GTGGATGGATGGATGGATGGATGGATGGTGGATGGATGGATGGATGGATGintronicDe novo--Yuen2017 G
EEF1A2     ASP067chr20:
62120532-62120532
CAintronicDe novo--Satterstrom2020 E
EEF1A2     SF0046031.p1chr20:
62119729-62119729
GCexonicDe novononsynonymous SNVNM_001958c.C1314Gp.I438M15.07-Wang2020 T
EEF1A2     2-1339-003chr20:
62126415-62126415
CTexonicDe novononsynonymous SNVNM_001958c.G364Ap.E122K34.0-Wang2020 T
Yuen2017 G
EEF1A2     91chr20:
62127325-62127325
CTexonicDe novononsynonymous SNVNM_001958c.G208Ap.G70S34.0-O’Roak2014 T
EEF1A2     1-0059-003chr20:
62134980-62134980
CTintergenicDe novo--Yuen2017 G
EEF1A2     AU2410302chr20:
62127170-62127170
CTintronicDe novo-2.59E-5Yuen2017 G
EEF1A2     Nakajima2014:1chr20:
62124508-62124508
CGexonicDe novononsynonymous SNVNM_001958c.G754Cp.D252H15.68-Nakajima2014 E
EEF1A2     7-0100-004chr20:
62129742-62129742
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More