Variant Results

or

or

Results for "HIPK1"

Variant Events: 10

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
HIPK1	SP0118780	chr1: 114499936-114499936	A	C	intronic		De novo					-	-	Fu2022 E
HIPK1	iHART1934	chr1: 114512690-114512690	C	T	exonic		Maternal	stopgain	NM_181358 NM_198269 NM_152696 NM_198268	c.C1702T c.C1762T c.C2884T c.C2884T	p.R568X p.R588X p.R962X p.R962X	19.28	-	Ruzzo2019 G
HIPK1	7-0461-003	chr1: 114483469-114483469	C	T	exonic		De novo	nonsynonymous SNV	NM_152696 NM_198268	c.C464T c.C464T	p.A155V p.A155V	12.25	-	Trost2022 G Zhou2022 GE
HIPK1	iHART1930	chr1: 114512690-114512690	C	T	exonic		Maternal	stopgain	NM_181358 NM_198269 NM_152696 NM_198268	c.C1702T c.C1762T c.C2884T c.C2884T	p.R568X p.R588X p.R962X p.R962X	19.28	-	Ruzzo2019 G
HIPK1	iHART1931	chr1: 114512690-114512690	C	T	exonic		Maternal	stopgain	NM_181358 NM_198269 NM_152696 NM_198268	c.C1702T c.C1762T c.C2884T c.C2884T	p.R568X p.R588X p.R962X p.R962X	19.28	-	Ruzzo2019 G
HIPK1	A59	chr1: 114483086-114483086	G	C	exonic		De novo	nonsynonymous SNV	NM_152696 NM_198268	c.G81C c.G81C	p.E27D p.E27D	25.3	-	Jiao2019 E
HIPK1	mAGRE1934	chr1: 114512690-114512690	C	T	exonic		Maternal	stopgain	NM_181358 NM_198269 NM_152696 NM_198268	c.C1702T c.C1762T c.C2884T c.C2884T	p.R568X p.R588X p.R962X p.R962X	19.28	-	Cirnigliaro2023 G
HIPK1	mAGRE1931	chr1: 114512690-114512690	C	T	exonic		Maternal	stopgain	NM_181358 NM_198269 NM_152696 NM_198268	c.C1702T c.C1762T c.C2884T c.C2884T	p.R568X p.R588X p.R962X p.R962X	19.28	-	Cirnigliaro2023 G
HIPK1	mAGRE1930	chr1: 114512690-114512690	C	T	exonic		Maternal	stopgain	NM_181358 NM_198269 NM_152696 NM_198268	c.C1702T c.C1762T c.C2884T c.C2884T	p.R568X p.R588X p.R962X p.R962X	19.28	-	Cirnigliaro2023 G
HIPK1	1-0636-003	chr1: 114472333-114472353	AGGCGGCGGCGGCGGCGGCGG	AGGCGGCGGCGGCGGCGG	intronic		De novo					-	-	Yuen2017 G

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More