or
or
Exact

Results for "UNC5C"

Variant Events: 40

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
UNC5C     1-0049-004chr4:
96316097-96316097
CTintronicDe novo--Yuen2017 G
UNC5C     1-0559-004chr4:
96364783-96364783
TCintronicDe novo--Yuen2017 G
UNC5C     3-0080-000chr4:
96522334-96522334
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
UNC5C     AU3632301chr4:
96445866-96445866
CAintronicDe novo--Yuen2017 G
UNC5C     AU4013302chr4:
96192436-96192436
TGintronicDe novo--Yuen2017 G
UNC5C     2-1357-004chr4:
96633958-96633958
GAintergenicDe novo--Yuen2017 G
UNC5C     AU4033304chr4:
96491606-96491606
GCintergenicDe novo--Yuen2017 G
UNC5C     2-1107-003chr4:
96678196-96678196
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
UNC5C     AU072905chr4:
96135844-96135844
AGintronicDe novo--Yuen2017 G
UNC5C     1-0092-003chr4:
96497014-96497014
TTCintergenicDe novo--Yuen2017 G
UNC5C     1-0701-003chr4:
96414052-96414052
TCintronicDe novo--Yuen2017 G
UNC5C     5-0116-003chr4:
96174414-96174414
TAintronicDe novo--Yuen2017 G
UNC5C     7-0167-003chr4:
96236863-96236863
ATintronicDe novo--Yuen2017 G
UNC5C     AU3698301chr4:
96530010-96530015
AATGATAATintergenicDe novo--Yuen2017 G
UNC5C     1-0344-003chr4:
96504636-96504636
GAintergenicDe novo--Yuen2017 G
UNC5C     AU2162302chr4:
96445533-96445533
CTintronicDe novo--Yuen2017 G
UNC5C     1-0448-003chr4:
96466974-96466974
CTintronicDe novo--Yuen2017 G
UNC5C     7-0250-003chr4:
96619335-96619335
GAintergenicDe novo--Yuen2017 G
UNC5C     1-0075-003chr4:
96158617-96158617
CTintronicDe novo--Yuen2017 G
UNC5C     1-0995-003chr4:
96192827-96192827
GTintronicDe novo--Yuen2017 G
UNC5C     5-0030-003chr4:
96113385-96113385
AGintronicDe novo--Yuen2017 G
UNC5C     1-0144-004chr4:
96301729-96301729
CGintronicDe novo--Yuen2017 G
UNC5C     13654.p1chr4:
96090347-96090347
TCUTR3De novo--Satterstrom2020 E
UNC5C     2-1302-003chr4:
96287959-96287959
GTintronicDe novo--Yuen2017 G
UNC5C     1-0065-004chr4:
96303886-96303886
AGintronicDe novo--Yuen2017 G
UNC5C     AU4485302chr4:
96607081-96607081
TAintergenicDe novo--Yuen2017 G
UNC5C     AU0452304chr4:
96226484-96226484
TCintronicDe novo--Yuen2017 G
UNC5C     AU4079302chr4:
96400203-96400203
TCintronicDe novo--Yuen2017 G
UNC5C     74-0355chr4:
96248589-96248589
CAintronicDe novo--Michaelson2012 G
UNC5C     1-0253-004chr4:
96603397-96603397
GAintergenicDe novo--Yuen2017 G
UNC5C     2-1721-003chr4:
96707804-96707804
TCintergenicDe novo--Yuen2017 G
UNC5C     AU059903chr4:
96599884-96599911
TACACACACACACATACACACACACACATACACACACACATACACACACACACAintergenicDe novo--Yuen2017 G
UNC5C     2-1605-003chr4:
96375755-96375755
TCintronicDe novo--Yuen2017 G
UNC5C     1-0203-004chr4:
96680899-96680901
CTGCintergenicDe novo--Yuen2017 G
UNC5C     2-1163-003chr4:
96696986-96696986
GTintergenicDe novo--Yuen2016 G
UNC5C     11117.p1 Complex Event; expand row to view variants  De novononframeshift deletion, nonframeshift substitutionNM_003728
NM_003728
c.7_9del
c.7_10T
p.3_3del
N/A
--Ji2016 E
Krumm2015 E
UNC5C     08C74292chr4:
96256683-96256683
TCexonicDe novononsynonymous SNVNM_003728c.A224Gp.K75R23.9-Satterstrom2020 E
UNC5C     AU4476302chr4:
96362963-96362963
GAintronicDe novo--Yuen2017 G
UNC5C     2-0006-004chr4:
96290372-96290377
TACTTGTintronicDe novo--Yuen2017 G
UNC5C     1-0257-003chr4:
96467942-96467942
TGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More