or
or
Exact

Results for "PRDM16"

Variant Events: 38

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PRDM16     1-0384-003chr1:
3235172-3235173
CTCTTintronicDe novo--Yuen2017 G
PRDM16     AU2162302chr1:
3341213-3341213
AATintronicDe novo--Yuen2017 G
PRDM16     1-1000-003chr1:
3195211-3195211
CTintronicDe novo--Yuen2017 G
PRDM16     2-0129-005chr1:
3211196-3211196
CTintronicDe novo--Yuen2017 G
PRDM16     2-1358-003chr1:
3339092-3339092
GTintronicDe novo--Yuen2017 G
PRDM16     1-0367-003chr1:
3160055-3160055
CTintronicDe novo--Yuen2017 G
PRDM16     1-0465-003chr1:
3177257-3177257
TTGATGGCGGCintronicDe novo--Yuen2017 G
PRDM16     AU1635302chr1:
3289878-3289878
GAintronicDe novo--Yuen2017 G
PRDM16     1-0004-003chr1:
3323170-3323170
GTintronicDe novo--Yuen2017 G
PRDM16     7-0068-003chr1:
3065473-3065473
GAintronicDe novo--Yuen2017 G
PRDM16     AU4314302chr1:
3078893-3078893
GAintronicDe novo--Yuen2017 G
PRDM16     2-1371-003chr1:
3253178-3253180
CTGCintronicDe novo--Yuen2016 G
PRDM16     AU4343302chr1:
3194128-3194128
TAintronicDe novo--Yuen2017 G
PRDM16     AU2756306chr1:
3128392-3128392
CTintronicDe novo--Yuen2017 G
PRDM16     2-0264-004chr1:
3097841-3097841
CTintronicDe novo--Yuen2017 G
PRDM16     AU4496301chr1:
3097768-3097768
AGintronicDe novo--Yuen2017 G
PRDM16     1-0206-003chr1:
3241103-3241103
CTintronicDe novo--Yuen2017 G
PRDM16     13722.p1chr1:
3322220-3322220
GCintronicDe novo--Krumm2015 E
PRDM16     2-1409-003chr1:
3131989-3131991
ATTATintronicDe novo--Yuen2017 G
PRDM16     AU076509chr1:
3175363-3175363
GAintronicDe novo--Yuen2017 G
PRDM16     2-1429-003chr1:
3177337-3177337
GTintronicDe novo--Yuen2017 G
PRDM16     09C81503chr1:
3342340-3342340
CTintronicDe novo--Satterstrom2020 E
PRDM16     14544.p1chr1:
3331090-3331090
GCintronicDe novo--Satterstrom2020 E
PRDM16     2-1244-003chr1:
3147942-3147942
GAintronicDe novo--Yuen2017 G
PRDM16     AU4093304chr1:
3263020-3263020
TCintronicDe novo--Yuen2017 G
PRDM16     11954chr1:
3160655-3160659
TACTGTexonicDe novoframeshift deletionNM_022114
NM_199454
c.393_396del
c.393_396del
p.I131fs
p.I131fs
--Satterstrom2020 E
PRDM16     AU3903301chr1:
3086719-3086719
CTintronicDe novo--Yuen2017 G
PRDM16     2-1283-004chr1:
3177337-3177337
GTintronicDe novo--Yuen2017 G
PRDM16     2-0081-003chr1:
3063920-3063920
GAintronicDe novo--Yuen2017 G
PRDM16     2-1561-003chr1:
3265179-3265179
CTintronicDe novo--Yuen2017 G
PRDM16     3-0447-000chr1:
3325629-3325629
GAintronicDe novo--Yuen2017 G
PRDM16     5-0133-003chr1:
3331426-3331426
GCintronicDe novo--Yuen2017 G
PRDM16     AU4015303chr1:
3263582-3263582
GAintronicDe novo--Yuen2017 G
PRDM16     AU0780301chr1:
3109856-3109856
CTintronicDe novo--Yuen2017 G
PRDM16     AU2139301chr1:
3213048-3213048
GAintronicDe novo--Yuen2017 G
PRDM16     2-0122-003chr1:
3325159-3325159
TTGTGAGAGTGTGAGTGTGAGCACintronicDe novo--Yuen2017 G
PRDM16     AU4072303chr1:
3179812-3179812
CTintronicDe novo--Yuen2017 G
PRDM16     AU071203chr1:
3017288-3017288
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More