or
or
Exact

Results for "IRF8"

Variant Events: 48

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
IRF8     1-0045-003chr16:
86047427-86047427
TCintergenicDe novo--Yuen2017 G
IRF8     1-0119-004chr16:
86047424-86047424
AACACCATCACCATCACCACintergenicDe novo--Yuen2017 G
IRF8     1-0289-004chr16:
86047427-86047427
TCintergenicDe novo--Yuen2017 G
IRF8     5-0116-003chr16:
86154149-86154149
GTintergenicDe novo--Yuen2017 G
IRF8     12429.p1chr16:
85952187-85952187
GAexonicDe novononsynonymous SNVNM_002163c.G766Ap.D256N19.538.864E-6Ji2016 E
Krumm2015 E
Satterstrom2020 E
IRF8     1-0107-003chr16:
86004076-86004076
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
IRF8     2-0090-003chr16:
86135647-86135647
GTintergenicDe novo--Yuen2017 G
IRF8     1-0289-004chr16:
86047706-86047706
GAintergenicDe novo--Yuen2017 G
IRF8     2-1644-003chr16:
86047427-86047427
TCintergenicDe novo--Yuen2017 G
IRF8     1-0541-004chr16:
86047706-86047706
GAintergenicDe novo--Yuen2017 G
IRF8     2-1594-003chr16:
86195078-86195078
GAintergenicDe novo--Yuen2017 G
IRF8     2-0090-003chr16:
86144644-86144644
CAintergenicDe novo--Yuen2017 G
IRF8     AU4223302chr16:
86024610-86024610
GAintergenicDe novo--Yuen2017 G
IRF8     1-0144-004chr16:
86047706-86047706
GAintergenicDe novo--Yuen2017 G
IRF8     AU0540301chr16:
85933144-85933144
GAintronicDe novo--Yuen2017 G
IRF8     AU4487302chr16:
86013616-86013616
GCintergenicDe novo--Yuen2017 G
IRF8     1-0329-004chr16:
86039940-86039940
CAintergenicDe novo--Yuen2017 G
IRF8     2-0135-004chr16:
86047706-86047706
GAintergenicDe novo--Yuen2017 G
IRF8     2-1391-003chr16:
86047420-86047420
TCintergenicDe novo--Yuen2017 G
IRF8     1-0079-008chr16:
86047427-86047427
TCintergenicDe novo--Yuen2017 G
IRF8     2-0214-003chr16:
86106571-86106571
CGintergenicDe novo--Yuen2017 G
IRF8     2-1497-003chr16:
86164206-86164206
TCintergenicDe novo--Yuen2017 G
IRF8     1-0150-003chr16:
86047427-86047427
TCintergenicDe novo--Yuen2017 G
IRF8     2-1318-004chr16:
86225609-86225609
TCintergenicDe novo--Yuen2017 G
IRF8     AU1860301chr16:
86129158-86129158
CTintergenicDe novo--Yuen2017 G
IRF8     2-1318-004chr16:
86217146-86217146
TCintergenicDe novo--Yuen2017 G
IRF8     1-0683-003chr16:
86047695-86047695
CCCATCATintergenicDe novo--Yuen2017 G
IRF8     1-0763-003chr16:
86047414-86047414
ACintergenicDe novo--Yuen2017 G
IRF8     2-1391-004chr16:
86047433-86047433
CCCATCACCATCATCACCATCATCACCTTCACCACCATintergenicDe novo--Yuen2017 G
IRF8     2-1415-004chr16:
86047427-86047427
TCintergenicDe novo--Yuen2017 G
IRF8     AU4234302chr16:
86153039-86153039
CTintergenicDe novo--Yuen2017 G
IRF8     5-0077-003chr16:
86173628-86173628
CTintergenicDe novo--Yuen2017 G
IRF8     2-1093-003chr16:
86047427-86047427
TCintergenicDe novo--Yuen2017 G
IRF8     AU3399302chr16:
86046989-86046989
ATintergenicDe novo--Yuen2017 G
IRF8     2-0070-004chr16:
86047448-86047448
TTCACCATCATCACCACCATCACCACCintergenicDe novo--Yuen2017 G
IRF8     1-0201-004chr16:
86047424-86047424
AACintergenicDe novo--Yuen2017 G
IRF8     1-0274-003chr16:
86047705-86047705
CCATCATCACTACCACAintergenicDe novo--Yuen2017 G
IRF8     2-0307-004chr16:
86047420-86047420
TCintergenicDe novo--Yuen2017 G
IRF8     1-0417-003chr16:
86086032-86086032
CTintergenicDe novo--Yuen2017 G
IRF8     AU066404chr16:
86154699-86154699
GTintergenicDe novo--Yuen2017 G
IRF8     2-1620-003chr16:
86047695-86047695
CCCATCATintergenicDe novo--Yuen2017 G
IRF8     2-0242-005chr16:
86047427-86047427
TCintergenicDe novo--Yuen2017 G
IRF8     7-0247-003chr16:
86142317-86142332
TTACTACTACTACTACTTACTACTACTACintergenicDe novo--Yuen2017 G
IRF8     AU060703chr16:
86226071-86226071
GAintergenicDe novo--Yuen2017 G
IRF8     1-0368-004chr16:
86047427-86047427
TCintergenicDe novo--Yuen2017 G
IRF8     AU3809302chr16:
85942733-85942733
CTexonicDe novosynonymous SNVNM_002163c.C312Tp.S104S-1.0E-4Yuen2017 G
IRF8     2-1283-004chr16:
86047414-86047414
ACintergenicDe novo--Yuen2017 G
IRF8     AU3725302chr16:
86017504-86017504
CAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More