or
or
Exact

Results for "PTPRT"

Variant Events: 93

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PTPRT     2-1442-003chr20:
41657372-41657372
ACintronicDe novo--Yuen2016 G
Yuen2017 G
PTPRT     AU4032306chr20:
41688427-41688429
TGGTGintronicDe novo--Yuen2017 G
PTPRT     AU3779301chr20:
40905567-40905567
TCintronicDe novo--Yuen2017 G
PTPRT     5-0110-003chr20:
41669636-41669636
GAintronicDe novo--Yuen2017 G
PTPRT     AU000704chr20:
41504816-41504816
TGintronicDe novo--Yuen2017 G
PTPRT     1-0534-004chr20:
41512281-41512281
GGCACACACACCCATAintronicDe novo--Yuen2017 G
PTPRT     2-0149-004chr20:
41512278-41512278
TTACACACACACCCATACACintronicDe novo--Yuen2017 G
PTPRT     2-0286-003chr20:
41512610-41512610
CCCCCTATACACTCCCATintronicDe novo--Yuen2017 G
PTPRT     2-1220-003chr20:
41385165-41385165
GAexonicDe novononsynonymous SNVNM_007050
NM_133170
c.C796T
c.C796T
p.R266C
p.R266C
34.08.472E-6Yuen2016 G
Yuen2017 G
PTPRT     2-1235-004chr20:
41503544-41503544
TCintronicDe novo--Yuen2017 G
PTPRT     7-0059-003chr20:
41092073-41092073
TAintronicDe novo--Yuen2017 G
PTPRT     AU2495301chr20:
41226267-41226267
GAintronicDe novo--Yuen2017 G
PTPRT     AU079605chr20:
41525088-41525088
CTintronicDe novo--Yuen2017 G
PTPRT     AU2089301chr20:
41148389-41148389
TCintronicDe novo--Yuen2017 G
PTPRT     2-1562-004chr20:
41512263-41512263
AACCintronicDe novo--Yuen2017 G
PTPRT     AU057503chr20:
41622729-41622729
CTintronicDe novo--Yuen2017 G
PTPRT     1-0324-003chr20:
41858069-41858069
CTintergenicDe novo--Yuen2017 G
PTPRT     1-0826-004chr20:
41512610-41512610
CCCCCTATintronicDe novo--Yuen2017 G
PTPRT     1-0972-003chr20:
41919856-41919856
CTintergenicDe novo--Yuen2017 G
PTPRT     AU3703302chr20:
41415675-41415675
AGintronicDe novo--Yuen2017 G
PTPRT     08C75650chr20:
41385165-41385165
GAexonicDe novononsynonymous SNVNM_007050
NM_133170
c.C796T
c.C796T
p.R266C
p.R266C
34.08.472E-6Satterstrom2020 E
PTPRT     PN400289chr20:
40733279-40733279
CTexonicUnknownnonsynonymous SNVNM_007050
NM_133170
c.G3470A
c.G3527A
p.R1157H
p.R1176H
33.01.0E-4Leblond2019 E
PTPRT     3-0246-000chr20:
41338836-41338836
GAintronicDe novo--Yuen2016 G
Yuen2017 G
PTPRT     2-0149-003chr20:
41103522-41103522
CAintronicDe novo--Yuen2017 G
PTPRT     2-1265-003chr20:
41869894-41869894
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
PTPRT     1-0009-004chr20:
41736000-41736000
ACintronicDe novo--Yuen2017 G
PTPRT     AU061104chr20:
41842616-41842616
TGintergenicDe novo--Yuen2017 G
PTPRT     1-0141-003chr20:
41260941-41260941
CTintronicDe novo--Yuen2017 G
PTPRT     1-0269-003chr20:
40840663-40840663
CCCAATTTCAAATTGGAAintronicDe novo--Yuen2017 G
PTPRT     2-0307-003chr20:
41512612-41512612
CCATintronicDe novo--Yuen2017 G
PTPRT     AU3648301chr20:
42073656-42073656
GAintergenicDe novo--Yuen2017 G
PTPRT     2-1635-004chr20:
40842720-40842720
AGintronicDe novo--Yuen2017 G
PTPRT     AU3617302chr20:
40998962-40998962
TCintronicDe novo--Yuen2017 G
PTPRT     AU1725306chr20:
41224819-41224819
CTintronicDe novo--Yuen2017 G
PTPRT     1-0175-003chr20:
41512283-41512283
AACACCintronicDe novo--Yuen2017 G
PTPRT     7-0151-003chr20:
41060950-41060950
ATintronicDe novo--Yuen2017 G
PTPRT     2-1277-004chr20:
41428430-41428430
GAintronicDe novo--Yuen2017 G
PTPRT     AU3076302chr20:
40834264-40834264
CAintronicDe novo--Yuen2017 G
PTPRT     3-0437-000chr20:
41945818-41945818
TGintergenicDe novo--Yuen2016 G
PTPRT     2-1437-003chr20:
41696822-41696822
AAAGGGAAGAAGintronicDe novo--Yuen2017 G
PTPRT     1-0651-003chr20:
42044895-42044895
CGintergenicDe novo--Yuen2017 G
PTPRT     5-0017-004chr20:
41512263-41512263
AACTCATATGCTintronicDe novo--Yuen2017 G
PTPRT     AU3997301chr20:
41710846-41710846
TCintronicDe novo--Yuen2017 G
PTPRT     1-0651-003chr20:
41760603-41760603
ACintronicDe novo--Yuen2017 G
PTPRT     7-0254-004chr20:
41445907-41445907
GAintronicDe novo--Yuen2017 G
PTPRT     AU3874301chr20:
41427052-41427052
GCintronicDe novo--Yuen2017 G
PTPRT     AU3885304chr20:
40918192-40918192
GAintronicDe novo--Yuen2017 G
PTPRT     AU075207chr20:
41720499-41720499
GAintronicDe novo--Yuen2017 G
PTPRT     AU4197301chr20:
40727818-40727841
TCATTCATCCATTCATCCATTCATTCATTCATCCATTCATintronicDe novo--Yuen2017 G
PTPRT     1-0045-003chr20:
41487348-41487348
TTGCTAAGAAATTTATGAintronicDe novo--Yuen2017 G
PTPRT     2-1485-004chr20:
40811904-40811904
TAintronicDe novo--Yuen2017 G
PTPRT     1-0914-003chr20:
41086681-41086681
GAintronicDe novo--Yuen2017 G
PTPRT     1-0045-003chr20:
41512252-41512252
AAATACACACCCACACCCCCATACACATGCACACACACTCCCintronicDe novo--Yuen2017 G
PTPRT     AU3702306chr20:
40946082-40946082
ACintronicDe novo--Yuen2017 G
PTPRT     2-1619-003chr20:
41512610-41512610
CCCCCTATintronicDe novo--Yuen2017 G
PTPRT     AU3713302chr20:
41084031-41084031
TCintronicDe novo--Yuen2017 G
PTPRT     AU2123302chr20:
41282739-41282739
GTintronicDe novo--Yuen2017 G
PTPRT     2-1518-003chr20:
41834010-41834010
TGintergenicDe novo--Yuen2017 G
PTPRT     7-0179-003chr20:
41527697-41527697
GAintronicDe novo--Yuen2017 G
PTPRT     AU4473301chr20:
41372120-41372120
GAintronicDe novo--Yuen2017 G
PTPRT     05HI3916Achr20:
41101200-41101200
GTexonicDe novononsynonymous SNVNM_007050
NM_133170
c.C1156A
c.C1156A
p.P386T
p.P386T
23.8-Satterstrom2020 E
PTPRT     2-0003-004chr20:
41512263-41512263
AACACACTCATATGCTintronicDe novo--Yuen2017 G
PTPRT     2-1364-003chr20:
41968035-41968035
CTintergenicDe novo--Yuen2017 G
PTPRT     13942.p1chr20:
41067667-41067667
TCintronicDe novo--Turner2016 G
PTPRT     14370.p1chr20:
41420515-41420515
CTintronicDe novo--Turner2016 G
PTPRT     2-1266-003chr20:
42082225-42082225
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
PTPRT     12011.p1chr20:
41420813-41420813
CTintronicDe novo--Turner2016 G
PTPRT     1-0563-004chr20:
41218296-41218296
CTintronicDe novo--Yuen2017 G
PTPRT     2-1291-003chr20:
41618161-41618161
CGintronicDe novo--Yuen2016 G
Yuen2017 G
PTPRT     7-0035-003chr20:
41901320-41901320
GAintergenicDe novo--Yuen2017 G
PTPRT     2-1089-003chr20:
41512255-41512255
AACACATGintronicDe novo--Yuen2017 G
PTPRT     1-0203-004chr20:
41661967-41661967
CTintronicDe novo--Yuen2017 G
PTPRT     AU3907301chr20:
40791757-40791757
CTintronicDe novo--Yuen2017 G
PTPRT     AU3907301chr20:
42011432-42011432
CTintergenicDe novo--Yuen2017 G
PTPRT     12198.p1chr20:
41419995-41419995
AGexonicDe novononsynonymous SNVNM_007050
NM_133170
c.T326C
c.T326C
p.F109S
p.F109S
18.378.29E-6Ji2016 E
Krumm2015 E
PTPRT     2-1485-003chr20:
40811904-40811904
TAintronicDe novo--Yuen2017 G
PTPRT     2-0019-004chr20:
41765115-41765115
CTintronicDe novo--Yuen2017 G
PTPRT     1-0215-006chr20:
41125125-41125125
CTintronicDe novo--Yuen2017 G
PTPRT     1-0965-003chr20:
42004321-42004321
TCintergenicDe novo--Yuen2017 G
PTPRT     2-0070-004chr20:
41632688-41632688
GCintronicDe novo--Yuen2017 G
PTPRT     2-1261-004chr20:
41699275-41699275
CAintronicDe novo--Yuen2017 G
PTPRT     AU3451301chr20:
41339569-41339569
TCintronicDe novo--Yuen2017 G
PTPRT     AU066206chr20:
42011126-42011126
GAintergenicDe novo--Yuen2017 G
PTPRT     2-1461-003chr20:
40998713-40998713
GAintronicDe novo--Yuen2016 G
Yuen2017 G
PTPRT     1-0044-003chr20:
41859957-41859957
CAintergenicDe novo--Yuen2017 G
PTPRT     2-0310-003chr20:
41324799-41324799
CAintronicDe novo--Yuen2017 G
PTPRT     2-1620-003chr20:
41512610-41512610
CCCCCTATintronicDe novo--Yuen2017 G
PTPRT     AU2458302chr20:
41932154-41932154
CTintergenicDe novo--Yuen2017 G
PTPRT     2-0310-003chr20:
41195812-41195812
CAintronicDe novo--Yuen2017 G
PTPRT     1336001chr20:
40738945-40738945
CTintronicDe novo--Satterstrom2020 E
PTPRT     AU3874303chr20:
41451374-41451374
AGintronicDe novo--Yuen2017 G
PTPRT     AU3713301chr20:
41546624-41546624
CTintronicDe novo--Yuen2017 G
PTPRT     2-1456-003chr20:
42051892-42051892
TCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More