or
or
Exact

Results for "DMD"

Variant Events: 105

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DMD     SP0118852chrX:
31792233-31792233
TCexonicsynonymous SNVNM_004013
NM_004020
NM_004021
NM_004022
NM_004023
NM_004011
NM_004012
NM_000109
NM_004006
NM_004009
NM_004010
c.A6G
c.A6G
c.A6G
c.A6G
c.A6G
c.A3363G
c.A3354G
c.A7362G
c.A7386G
c.A7374G
c.A7017G
p.P2P
p.P2P
p.P2P
p.P2P
p.P2P
p.P1121P
p.P1118P
p.P2454P
p.P2462P
p.P2458P
p.P2339P
10.11.144E-5Zhou2022 GE
DMD     2-0109-003chrX:
32658186-32658186
TAintronicDe novo--Yuen2017 G
DMD     AU2458302chrX:
32270984-32271003
TAAATATATAAAAATATATATAAATATATAintronicDe novo--Yuen2017 G
DMD     1-0520-003chrX:
33028183-33028195
ATACACAAATGTGAintronicDe novo--Yuen2017 G
DMD     AU002406chrX:
34118898-34118898
GAintergenicDe novo--Yuen2017 G
DMD     AU2495301chrX:
31398563-31398563
CTintronicDe novo--Yuen2017 G
DMD     SP0025437chrX:
32632434-32632434
CTexonicMosaicnonsynonymous SNVNM_000109
NM_004006
NM_004009
NM_004010
c.G1444A
c.G1468A
c.G1456A
c.G1099A
p.V482I
p.V490I
p.V486I
p.V367I
3.637-Feliciano2019 E
DMD     AU3586303chrX:
32354194-32354196
CATCintronicDe novo--Yuen2017 G
DMD     AU038203chrX:
32657426-32657426
ATintronicDe novo--Yuen2017 G
DMD     AU3881301chrX:
33745922-33745922
CTintergenicDe novo--Yuen2017 G
DMD     2-1305-003chrX:
33027633-33027638
ATATGTATintronicDe novo--Yuen2017 G
DMD     2-1380-003chrX:
33149978-33149978
GCintronicDe novo--Yuen2017 G
DMD     PN400538chrX:
32407727-32407727
CTexonicUnknownnonsynonymous SNVNM_004011
NM_004012
NM_000109
NM_004006
NM_004009
NM_004010
c.G386A
c.G377A
c.G4385A
c.G4409A
c.G4397A
c.G4040A
p.R129H
p.R126H
p.R1462H
p.R1470H
p.R1466H
p.R1347H
33.0-Leblond2019 E
DMD     1-0772-003chrX:
33406690-33406700
GTTTTTTTTTTGTTTTTTTTTTTintergenicDe novo--Yuen2017 G
DMD     2-1242-003chrX:
33937166-33937169
CTTTCTintergenicDe novo--Yuen2017 G
DMD     3-0428-000chrX:
32594048-32594048
AGintronicDe novo--Yuen2017 G
DMD     2-1107-003chrX:
32786669-32786669
TGintronicDe novo--Yuen2017 G
DMD     AU2381302chrX:
31638123-31638123
TCintronicDe novo--Yuen2017 G
DMD     1-0553-003chrX:
32406880-32406880
CTintronicDe novo--Yuen2017 G
DMD     1-0606-003chrX:
31139549-31139568
GTGTGTGTGTATGTGTGTGTGTGTGTGTGTUTR3De novo--Yuen2017 G
DMD     13062.p1chrX:
32383221-32383221
CTexonicMosaicsynonymous SNVNM_004011
NM_004012
NM_000109
NM_004006
NM_004009
NM_004010
c.G918A
c.G909A
c.G4917A
c.G4941A
c.G4929A
c.G4572A
p.T306T
p.T303T
p.T1639T
p.T1647T
p.T1643T
p.T1524T
-3.427E-5Dou2017 E
Krupp2017 E
DMD     1-0553-003chrX:
31827973-31827973
GTintronicDe novo--Yuen2017 G
DMD     1-0225-003chrX:
32801252-32801264
GTATATATATATAGTATATATATATATAintronicDe novo--Yuen2017 G
DMD     AU4007301chrX:
33383600-33383601
ATAintergenicDe novo--Yuen2017 G
DMD     1-0487-003chrX:
33396646-33396646
CAintergenicDe novo--Yuen2017 G
DMD     1-0871-003chrX:
32353959-32353962
ATATATATGTATintronicDe novo--Yuen2017 G
DMD     2-1330-003chrX:
32364157-32364157
CAexonicInheritednonsynonymous SNVNM_004011
NM_004012
NM_000109
NM_004006
NM_004009
NM_004010
c.G1466T
c.G1457T
c.G5465T
c.G5489T
c.G5477T
c.G5120T
p.R489I
p.R486I
p.R1822I
p.R1830I
p.R1826I
p.R1707I
20.53.503E-5Jiang2013 G
DMD     5-0114-003chrX:
32470525-32470534
AGGGAAAGGGAGGintronicDe novo--Yuen2017 G
DMD     AU4433301chrX:
33937166-33937169
CTTTCTintergenicDe novo--Yuen2017 G
DMD     AU3760302chrX:
33507961-33507961
CAintergenicDe novo--Yuen2017 G
DMD     AU3912301chrX:
32470525-32470528
AGGGAGGintronicDe novo--Yuen2017 G
DMD     14621.p1chrX:
33724214-33724214
GGTintergenicDe novo--Wilfert2021 G
DMD     AU3763305chrX:
34119722-34119727
AAACAAAAAintergenicDe novo--Yuen2017 G
DMD     AU051503chrX:
33220376-33220376
CTintronicDe novo--Yuen2017 G
DMD     AU4154303chrX:
32094195-32094208
AAAAAAAAAAGAGAAAintronicDe novo--Yuen2017 G
DMD     1-0150-004chrX:
33367607-33367607
GGTGTGTGTGTGTATATGTAintergenicDe novo--Yuen2017 G
DMD     1-0150-004chrX:
32696490-32696490
AGintronicDe novo--Yuen2017 G
DMD     A11chrX:
33648990-33648991
GTGintergenicDe novo--Wu2018 G
DMD     PN400540chrX:
32407727-32407727
CTexonicUnknownnonsynonymous SNVNM_004011
NM_004012
NM_000109
NM_004006
NM_004009
NM_004010
c.G386A
c.G377A
c.G4385A
c.G4409A
c.G4397A
c.G4040A
p.R129H
p.R126H
p.R1462H
p.R1470H
p.R1466H
p.R1347H
33.0-Leblond2019 E
DMD     AU3794301chrX:
33522429-33522432
GAAAGAAAGAAAAAintergenicDe novo--Yuen2017 G
DMD     2-1549-003chrX:
32824452-32824455
AACAAAintronicDe novo--Yuen2017 G
DMD     AU3698301chrX:
31139351-31139362
CATATAGATATACATATAUTR3De novo--Yuen2017 G
DMD     1-0394-003chrX:
31431154-31431154
CTintronicDe novo--Yuen2017 G
DMD     Codina-Sola2015:ASD_30chrX:
31697642-31697642
CGexonicMaternalnonsynonymous SNVNM_004013
NM_004020
NM_004021
NM_004022
NM_004023
NM_004011
NM_004012
NM_000109
NM_004006
NM_004009
NM_004010
c.G342C
c.G342C
c.G342C
c.G342C
c.G342C
c.G3699C
c.G3690C
c.G7698C
c.G7722C
c.G7710C
c.G7353C
p.Q114H
p.Q114H
p.Q114H
p.Q114H
p.Q114H
p.Q1233H
p.Q1230H
p.Q2566H
p.Q2574H
p.Q2570H
p.Q2451H
17.311.142E-5Codina-Sola2015 E
DMD     2-0319-004chrX:
31379018-31379018
CTintronicDe novo--Yuen2017 G
DMD     AU038204chrX:
32657426-32657426
ATintronicDe novo--Yuen2017 G
DMD     AU3846302chrX:
32846693-32846696
TATATATACATAintronicDe novo--Yuen2017 G
DMD     AU062204chrX:
32828061-32828074
AAAGAAAGAAAGAAAAAintronicDe novo--Yuen2017 G
DMD     5-0110-003chrX:
33027583-33027590
ATGTGTGTATGTintronicDe novo--Yuen2017 G
DMD     AU1987301chrX:
32485947-32485953
GTAATAAGTAAintronicDe novo--Yuen2017 G
DMD     AU4122301chrX:
31429037-31429038
TGTintronicDe novo--Yuen2017 G
DMD     2-0208-003chrX:
32045275-32045275
GGTGCACACACACACAintronicDe novo--Yuen2017 G
DMD     AU3645301chrX:
31411596-31411625
AAAAAAAAAAAAACAAAAAAAAAAAACAAAAAAAAAAAAAAAACAAAintronicDe novo--Yuen2017 G
DMD     13393.p1chrX:
34022298-34022298
AGintergenicDe novo--Turner2016 G
DMD     2-1300-003chrX:
31840771-31840772
GTGintronicDe novo--Yuen2017 G
DMD     5-0116-003 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
DMD     5-0116-003chrX:
33327830-33327830
GAintronicDe novo--Yuen2017 G
DMD     2-1632-003chrX:
31553481-31553481
CAintronicDe novo--Yuen2017 G
DMD     AU4007302chrX:
33772374-33772374
AGintergenicDe novo--Yuen2017 G
DMD     1-0652-004chrX:
31229285-31229285
ATintronicDe novo--Yuen2017 G
DMD     1-0756-005chrX:
32534568-32534568
GAintronicDe novo--Yuen2017 G
DMD     1-0305-004chrX:
31484826-31484826
TGintronicDe novo--Yuen2017 G
DMD     SSC10917chrX:
32430306-32430306
TAexonicDe novosynonymous SNVNM_004011c.A21Tp.L7L--Trost2022 G
DMD     AU4060306chrX:
33862328-33862338
CTTTTTTTTTTCTTTTTTTTTintergenicDe novo--Yuen2017 G
DMD     2-0002-005chrX:
32877021-32877021
TCintronicDe novo--Yuen2017 G
DMD     2-1131-003chrX:
32766500-32766500
AGintronicDe novo--Yuen2017 G
DMD     AU072505chrX:
33937112-33937119
TTTGTCTTTTTGTCTTGTCTTintergenicDe novo--Yuen2017 G
DMD     2-1005-003chrX:
31956326-31956326
GAintronicDe novo--Yuen2017 G
DMD     5-0128-003chrX:
32828061-32828074
AAAGAAAGAAAGAAAAAintronicDe novo--Yuen2017 G
DMD     7-0008-003chrX:
32836192-32836192
TCintronicDe novo--Yuen2017 G
DMD     AU3782303chrX:
31411596-31411625
AAAAAAAAAAAAACAAAAAAAAAAAACAAAAAAAAAAAAAAAACAAAintronicDe novo--Yuen2017 G
DMD     7-0250-003chrX:
34142006-34142006
ATintergenicDe novo--Yuen2017 G
DMD     11C119366chrX:
31496407-31496407
ACexonicDe novononsynonymous SNVNM_004014
NM_004013
NM_004020
NM_004021
NM_004022
NM_004023
NM_004011
NM_004012
NM_000109
NM_004006
NM_004009
NM_004010
c.T566G
c.T1373G
c.T1373G
c.T1373G
c.T1373G
c.T1373G
c.T4730G
c.T4721G
c.T8729G
c.T8753G
c.T8741G
c.T8384G
p.L189W
p.L458W
p.L458W
p.L458W
p.L458W
p.L458W
p.L1577W
p.L1574W
p.L2910W
p.L2918W
p.L2914W
p.L2795W
22.21.141E-5Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DMD     14230.p1chrX:
32430306-32430306
TAexonicDe novosynonymous SNVNM_004011c.A21Tp.L7L--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
DMD     2-1169-003chrX:
33722619-33722619
AGintergenicDe novo--Yuen2017 G
DMD     2-1251-003chrX:
33082667-33082667
CTintronicDe novo--Yuen2017 G
DMD     AU1988302chrX:
32634816-32634836
TTTTTTTTTTTTTTTTTCTTTTTTTintronicDe novo--Yuen2017 G
DMD     BRK-43–01chrX:
32663098-32663098
GCexonicUnknownnonsynonymous SNVNM_000109
NM_004006
NM_004009
NM_004010
c.C1108G
c.C1132G
c.C1120G
c.C763G
p.Q370E
p.Q378E
p.Q374E
p.Q255E
17.57-Abdi2023 G
DMD     1-0668-003chrX:
33937130-33937145
CTTTCTTTCTTTCTTTCTintergenicDe novo--Yuen2017 G
DMD     1-0046-003chrX:
32354195-32354199
ATGTTATintronicDe novo--Yuen2017 G
DMD     PN400457chrX:
31140000-31140013
CTCTGCCCAAATCACexonicUnknownframeshift deletionNM_004018
NM_004016
NM_004023
NM_004022
NM_004021
c.1806_1818del
c.1845_1857del
c.3339_3351del
c.3630_3642del
c.3669_3681del
p.D602fs
p.D615fs
p.D1113fs
p.D1210fs
p.D1223fs
-3.0E-4Leblond2019 E
DMD     AU043804chrX:
31384645-31384667
TAAAAGAAAAAAAAGAAAAAAAATAAAAGAAAAAAAAintronicDe novo--Yuen2017 G
DMD     7-0256-003chrX:
33541813-33541813
GTintergenicDe novo--Yuen2017 G
DMD     AU2711303chrX:
32094193-32094208
AAAAAAAAAAAAGAGAAAintronicDe novo--Yuen2017 G
DMD     AU3702306chrX:
32298273-32298288
ATATATACAGTATATAATATATAintronicDe novo--Yuen2017 G
DMD     Kenny2014:9chrX:
32429867-32429867
GAsplicingUnknownsplicing16.695.0E-4Kenny2014 T
DMD     1-0271-004chrX:
31337684-31337684
TCintronicDe novo--Yuen2017 G
DMD     AU012804chrX:
32072207-32072207
ATintronicDe novo--Yuen2017 G
DMD     1-0367-003chrX:
32573098-32573099
GAGAAAintronicDe novo--Yuen2017 G
DMD     AU3777301chrX:
31441988-31441988
TCintronicDe novo--Yuen2017 G
DMD     ASD057chrX:
32663092-32663092
GAexonicInheritednonsynonymous SNVNM_000109
NM_004006
NM_004009
NM_004010
c.C1114T
c.C1138T
c.C1126T
c.C769T
p.H372Y
p.H380Y
p.H376Y
p.H257Y
15.78-Tran2020 E
Wu2019 E
DMD     AU4032307chrX:
31863505-31863514
TCTCTCTCTCTCTCTCTCTCCCTCTCTCTCintronicDe novo--Yuen2017 G
DMD     ASD059chrX:
32490353-32490353
TGexonicInheritednonsynonymous SNVNM_000109
NM_004006
NM_004009
NM_004010
c.A2853C
c.A2877C
c.A2865C
c.A2508C
p.E951D
p.E959D
p.E955D
p.E836D
16.17-Tran2020 E
Wu2019 E
DMD     AU3610302chrX:
33378827-33378834
CAAATAAACAAAintergenicDe novo--Yuen2017 G
DMD     1-0206-005chrX:
32708683-32708683
AGintronicDe novo--Yuen2017 G
DMD     AU4359301chrX:
32801406-32801413
TACACACATACACAintronicDe novo--Yuen2017 G
DMD     AU003405chrX:
32581845-32581845
AGintronicDe novo--Yuen2017 G
DMD     2-1132-003chrX:
32355921-32355921
CAintronicDe novo--Yuen2017 G
DMD     2-1366-003chrX:
32616865-32616865
ATintronicDe novo--Yuen2017 G
DMD     AU1848302chrX:
33894559-33894559
AGintergenicDe novo--Yuen2017 G
DMD     1-0073-003chrX:
33449761-33449761
TCintergenicDe novo--Yuen2017 G
DMD     2-1132-003chrX:
33852170-33852170
GGGCintergenicDe novo--Yuen2017 G
DMD     3-0072-000chrX:
31515026-31515026
CTexonicnonsynonymous SNVNM_004014
NM_004013
NM_004020
NM_004021
NM_004022
NM_004023
NM_004011
NM_004012
NM_000109
NM_004006
NM_004009
NM_004010
c.G239A
c.G1046A
c.G1046A
c.G1046A
c.G1046A
c.G1046A
c.G4403A
c.G4394A
c.G8402A
c.G8426A
c.G8414A
c.G8057A
p.R80H
p.R349H
p.R349H
p.R349H
p.R349H
p.R349H
p.R1468H
p.R1465H
p.R2801H
p.R2809H
p.R2805H
p.R2686H
17.61.43E-5Zhou2022 GE
DMD     4-0001-003chrX:
31496407-31496407
ACexonicnonsynonymous SNVNM_004014
NM_004013
NM_004020
NM_004021
NM_004022
NM_004023
NM_004011
NM_004012
NM_000109
NM_004006
NM_004009
NM_004010
c.T566G
c.T1373G
c.T1373G
c.T1373G
c.T1373G
c.T1373G
c.T4730G
c.T4721G
c.T8729G
c.T8753G
c.T8741G
c.T8384G
p.L189W
p.L458W
p.L458W
p.L458W
p.L458W
p.L458W
p.L1577W
p.L1574W
p.L2910W
p.L2918W
p.L2914W
p.L2795W
22.21.141E-5Zhou2022 GE
DMD     AU2137304chrX:
32573074-32573085
GAGAAAGAAAGAGAGAAAGAAAGAAAGAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More