or
or
Exact

Results for "ERBB4"

Variant Events: 77

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ERBB4     2-1180-003chr2:
212335361-212335361
TGintronicDe novo--Yuen2016 G
Yuen2017 G
ERBB4     1-0443-003chr2:
212320643-212320643
GGCintronicDe novo--Yuen2016 G
ERBB4     1-0567-003chr2:
212332141-212332141
CGintronicDe novo--Yuen2017 G
ERBB4     1-0323-004chr2:
212720023-212720023
GAintronicDe novo--Yuen2017 G
ERBB4     2-1362-004chr2:
213220047-213220047
AGintronicDe novo--Yuen2017 G
ERBB4     2-1366-003chr2:
212876307-212876307
CTintronicDe novo--Yuen2017 G
ERBB4     AU025704chr2:
212807719-212807719
ACintronicDe novo--Yuen2017 G
ERBB4     2-1456-004chr2:
212526045-212526048
GAACGintronicDe novo--Yuen2017 G
ERBB4     1-0382-004chr2:
212283047-212283047
GAintronicDe novo--Yuen2017 G
ERBB4     AU4359301chr2:
213003902-213003902
CTintronicDe novo--Yuen2017 G
ERBB4     1-0638-003chr2:
212550763-212550763
GAintronicDe novo--Yuen2017 G
ERBB4     2-1594-003chr2:
212748324-212748324
TAintronicDe novo--Yuen2017 G
ERBB4     1-0745-003chr2:
212524504-212524504
TAintronicDe novo--Yuen2017 G
ERBB4     2-1509-003chr2:
213249955-213249964
ATATATTATAATATAintronicDe novo--Yuen2017 G
ERBB4     AU3636301chr2:
213362391-213362391
CAintronicDe novo--Yuen2017 G
ERBB4     2-0256-004chr2:
213061744-213061744
GAintronicDe novo--Yuen2017 G
ERBB4     5-0117-003chr2:
212354562-212354562
ATintronicDe novo--Yuen2017 G
ERBB4     7-0067-003chr2:
212900122-212900122
TCintronicDe novo--Yuen2017 G
ERBB4     2-0285-003chr2:
212736845-212736845
CTintronicDe novo--Yuen2017 G
ERBB4     Lim2017:36742chr2:
212522487-212522487
TCexonicDe novosynonymous SNVNM_001042599
NM_005235
c.A1938G
c.A1938G
p.Q646Q
p.Q646Q
--Lim2017 E
ERBB4     2-0318-004chr2:
212418491-212418491
TCintronicDe novo--Yuen2017 G
ERBB4     1-0460-003chr2:
213358490-213358490
GAintronicDe novo--Yuen2017 G
ERBB4     AU2109302chr2:
213091418-213091418
TCintronicDe novo--Yuen2017 G
ERBB4     11905.p1chr2:
212578279-212578279
GTexonicMosaicstopgainNM_001042599
NM_005235
c.C978A
c.C978A
p.C326X
p.C326X
33.0-Dou2017 E
ERBB4     AU4410302chr2:
212910432-212910432
GCintronicDe novo--Yuen2017 G
ERBB4     1-0757-003chr2:
212854517-212854517
CTintronicDe novo--Yuen2017 G
ERBB4     5-0003-003chr2:
212586772-212586772
GAintronicDe novo--Yuen2017 G
ERBB4     1-0065-005chr2:
212863320-212863323
ATTTAintronicDe novo--Yuen2017 G
ERBB4     1-0524-003chr2:
212450885-212450885
AGintronicDe novo--Yuen2017 G
ERBB4     PN400128chr2:
212289007-212289007
CCAGTTCCCATATAGTAACTCCTATATTGGAGAAAAexonicUnknownframeshift insertionNM_001042599
NM_005235
c.2738_2739insTTTTCTCCAATATAGGAGTTACTATATGGGAACT
c.2738_2739insTTTTCTCCAATATAGGAGTTACTATATGGGAACT
p.L913fs
p.L913fs
--Leblond2019 E
ERBB4     1-0303-004chr2:
213248962-213248962
GAintronicDe novo--Yuen2017 G
ERBB4     AU3786301chr2:
213585587-213585587
AGintergenicDe novo--Yuen2017 G
ERBB4     1-0303-004chr2:
213246163-213246163
CAintronicDe novo--Yuen2017 G
ERBB4     2-1350-004chr2:
212606792-212606792
GTintronicDe novo--Yuen2017 G
ERBB4     2-1416-004chr2:
212867163-212867163
CTintronicDe novo--Yuen2017 G
ERBB4     AU4015303chr2:
212987600-212987600
CTintronicDe novo--Yuen2017 G
ERBB4     7-0188-003chr2:
212773502-212773502
AGintronicDe novo--Yuen2017 G
ERBB4     AU0039303chr2:
213297711-213297711
TCintronicDe novo--Yuen2017 G
ERBB4     1-0295-003chr2:
212653615-212653615
AGintronicDe novo--Yuen2017 G
ERBB4     1-0433-003chr2:
212609825-212609825
AGintronicDe novo--Yuen2017 G
ERBB4     1-0295-003chr2:
213080158-213080165
CTGTGTGTCTGTintronicDe novo--Yuen2017 G
ERBB4     1-0372-003chr2:
212253825-212253825
AGintronicDe novo--Yuen2017 G
ERBB4     PN400489chr2:
212289007-212289007
CCAGTTCCCATATAGTAACTCCTATATTGGAGAAAAexonicUnknownframeshift insertionNM_001042599
NM_005235
c.2738_2739insTTTTCTCCAATATAGGAGTTACTATATGGGAACT
c.2738_2739insTTTTCTCCAATATAGGAGTTACTATATGGGAACT
p.L913fs
p.L913fs
--Leblond2019 E
ERBB4     2-1399-003chr2:
213024898-213024898
CTintronicDe novo--Yuen2017 G
ERBB4     2-1168-003chr2:
212376471-212376471
TCintronicDe novo--Yuen2016 G
Yuen2017 G
ERBB4     AU4092302chr2:
213362522-213362522
TCintronicDe novo--Yuen2017 G
ERBB4     2-1189-003chr2:
213526912-213526912
CAintergenicDe novo--Yuen2017 G
ERBB4     AU026412chr2:
212645313-212645313
TCintronicDe novo--Yuen2017 G
ERBB4     1-0450-003chr2:
212727950-212727950
GCintronicDe novo--Yuen2017 G
ERBB4     3-0434-000chr2:
212959707-212959707
CAintronicDe novo--Yuen2017 G
ERBB4     1-0841-003chr2:
212521371-212521371
CTintronicDe novo--Yuen2017 G
ERBB4     AU038203chr2:
213267816-213267819
CAAACAAintronicDe novo--Yuen2017 G
ERBB4     AU045010chr2:
213656422-213656422
CTintergenicDe novo--Yuen2017 G
ERBB4     1-0677-003chr2:
212569761-212569761
ACintronicDe novo--Yuen2017 G
ERBB4     5-0065-003chr2:
213557346-213557346
AGintergenicDe novo--Yuen2017 G
ERBB4     Codina-Sola2015:ASD_19chr2:
212495269-212495269
AGexonicPaternalnonsynonymous SNVNM_001042599
NM_005235
c.T1997C
c.T1997C
p.I666T
p.I666T
23.28.243E-6Codina-Sola2015 E
ERBB4     AU3368302chr2:
213628035-213628035
GTintergenicDe novo--Yuen2017 G
ERBB4     2-1526-004chr2:
212926219-212926222
GACAGintronicDe novo--Yuen2017 G
ERBB4     2-0144-004chr2:
213445572-213445573
TATintergenicDe novo--Yuen2017 G
ERBB4     13649.p1chr2:
212624578-212624578
CTintronicDe novo--Turner2016 G
ERBB4     AU3702307chr2:
213014423-213014423
TCintronicDe novo--Yuen2017 G
ERBB4     13023.p1chr2:
213226763-213226763
TCintronicDe novo--Turner2016 G
ERBB4     AU2129301chr2:
213160059-213160059
GTintronicDe novo--Yuen2017 G
ERBB4     AU4015302chr2:
212987600-212987600
CTintronicDe novo--Yuen2017 G
ERBB4     14590.p1chr2:
213381054-213381054
TAintronicDe novo--Turner2016 G
ERBB4     1-0402-004chr2:
212824244-212824244
TCintronicDe novo--Yuen2017 G
ERBB4     AU047904chr2:
213437102-213437102
CTintergenicDe novo--Yuen2017 G
ERBB4     5-0014-004chr2:
212422387-212422387
CCATTGTTGTintronicDe novo--Yuen2017 G
ERBB4     11860.p1chr2:
212569993-212569993
TAintronicDe novo-2.0E-4Satterstrom2020 E
ERBB4     14509.p1chr2:
212522487-212522487
TCexonicDe novosynonymous SNVNM_001042599
NM_005235
c.A1938G
c.A1938G
p.Q646Q
p.Q646Q
--Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
ERBB4     2-1425-004chr2:
213212426-213212426
TGintronicDe novo--Yuen2017 G
ERBB4     2-1737-003chr2:
213393023-213393023
TCintronicDe novo--Yuen2017 G
ERBB4     1-0661-003chr2:
212561586-212561586
GAintronicDe novo--Yuen2017 G
ERBB4     1-0169-003chr2:
213385487-213385487
AGintronicDe novo--Yuen2017 G
ERBB4     2-1188-003chr2:
212341824-212341824
TCintronicDe novo--Yuen2017 G
ERBB4     2-1416-003chr2:
212867163-212867163
CTintronicDe novo--Yuen2017 G
ERBB4     AU2410302chr2:
212406264-212406264
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More