or
or
Exact

Results for "NCOR2"

Variant Events: 114

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NCOR2     1-0219-003chr12:
125112246-125112246
GAintergenicDe novo--Yuen2017 G
NCOR2     AU2072302chr12:
125106756-125106756
GAintergenicDe novo--Yuen2017 G
NCOR2     2-0197-004chr12:
124821824-124821824
CAintronicDe novo--Yuen2017 G
NCOR2     SP0002452chr12:
124950670-124950670
GAintronicDe novo-6.87E-5Fu2022 E
NCOR2     AU057405chr12:
125010893-125010893
GAintronicDe novo--Yuen2017 G
NCOR2     11456.p1chr12:
125090768-125090768
GAintergenicDe novo--Turner2016 G
NCOR2     2-1333-003chr12:
124897746-124897746
CTintronicDe novo--Trost2022 G
Yuen2017 G
NCOR2     AU3782302chr12:
124807551-124807556
GTATATGTATintergenicDe novo--Yuen2017 G
NCOR2     AU3782302chr12:
125151973-125151973
GAintergenicDe novo--Yuen2017 G
NCOR2     5-0050-004chr12:
124844096-124844101
TGGAGGTintronicDe novo--Trost2022 G
Yuen2017 G
NCOR2     AU4013301chr12:
124915828-124915829
GAGATAintronicDe novo--Yuen2017 G
NCOR2     Bruno2021:VIIchr12:
124827626-124827626
CTexonicPaternalnonsynonymous SNVNM_001077261
NM_001206654
NM_006312
c.G4831A
c.G4831A
c.G4861A
p.V1611M
p.V1611M
p.V1621M
11.411.701E-5Bruno2021 E
NCOR2     SP0130992chr12:
124821225-124821225
CTintronicDe novo--Fu2022 E
Trost2022 G
NCOR2     SP0053143chr12:
124829312-124829312
GAexonicDe novosynonymous SNVNM_001077261
NM_001206654
NM_006312
c.C4515T
c.C4515T
c.C4545T
p.A1505A
p.A1505A
p.A1515A
--Fu2022 E
Trost2022 G
Zhou2022 GE
NCOR2     Bruno2021:VIIchr12:
124824869-124824869
GAexonicMaternalnonsynonymous SNVNM_001077261
NM_001206654
NM_006312
c.C5429T
c.C5429T
c.C5459T
p.T1810M
p.T1810M
p.T1820M
8.8530.0047Bruno2021 E
NCOR2     SP0077949chr12:
124841436-124841446
TGGCCTGTGACTintronicDe novo--Fu2022 E
NCOR2     SP0061610chr12:
124824560-124824560
CTexonicDe novosynonymous SNVNM_001077261
NM_001206654
NM_006312
c.G5649A
c.G5649A
c.G5679A
p.T1883T
p.T1883T
p.T1893T
9.3215.895E-5Fu2022 E
Trost2022 G
Zhou2022 GE
NCOR2     5-0131-003chr12:
125082279-125082279
AGintergenicDe novo--Yuen2017 G
NCOR2     More2023:10chr12:
124832388-124832388
CTexonicInheritednonsynonymous SNVNM_001077261
NM_001206654
NM_006312
c.G4025A
c.G4025A
c.G4055A
p.R1342H
p.R1342H
p.R1352H
13.880.0091More2023 G
NCOR2     2-1137-003chr12:
124844689-124844689
GAintronicDe novo--Trost2022 G
Yuen2017 G
NCOR2     14607_p1chr12:
124831242-124831242
CTexonicDe novosynonymous SNVNM_001077261
NM_001206654
NM_006312
c.G4197A
c.G4197A
c.G4227A
p.P1399P
p.P1399P
p.P1409P
-1.0E-4Fu2022 E
NCOR2     AU0039303chr12:
124901081-124901110
CCCCGCGGCACAGGGAGACCCGCGGCACAGCCCCGCGGCACAGintronicDe novo--Yuen2017 G
NCOR2     2-1153-003chr12:
124834012-124834012
CTintronicDe novo--Trost2022 G
Yuen2017 G
NCOR2     1-0305-004chr12:
124892925-124892925
TCintronicDe novo--Trost2022 G
Yuen2017 G
NCOR2     REACH000159chr12:
124837333-124837333
AGintronicDe novo--Trost2022 G
NCOR2     SP0251650chr12:
124846684-124846684
CTexonicDe novononsynonymous SNVNM_001077261
NM_001206654
NM_006312
c.G3034A
c.G3034A
c.G3088A
p.A1012T
p.A1012T
p.A1030T
5.4995.0E-4Trost2022 G
NCOR2     MSSNG00252-003chr12:
124831868-124831868
CTintronicDe novo--Trost2022 G
NCOR2     2661_18auchr12:
124815498-124815498
CTintronicDe novo--Fu2022 E
NCOR2     AU3951301chr12:
124972757-124972757
CGintronicDe novo--Trost2022 G
Yuen2017 G
NCOR2     SP0015397chr12:
124884993-124884993
ACintronicDe novo--Trost2022 G
NCOR2     SP0023236 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     1-1238-003chr12:
124879398-124879398
CTintronicDe novo--Trost2022 G
NCOR2     SP0010928 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     AU4176302chr12:
125090842-125090842
CTintergenicDe novo--Yuen2017 G
NCOR2     AU070007chr12:
124863560-124863560
AGintronicDe novo--Trost2022 G
NCOR2     1-0589-003chr12:
124873333-124873333
CAintronicDe novo--Trost2022 G
NCOR2     1-0296-004chr12:
125139613-125139613
GAintergenicDe novo--Yuen2017 G
NCOR2     3-0534-000chr12:
124851499-124851499
ACintronicDe novo--Trost2022 G
NCOR2     SP0176459chr12:
124862916-124862916
GAexonicDe novosynonymous SNVNM_001077261
NM_001206654
NM_006312
c.C2031T
c.C2031T
c.C2034T
p.N677N
p.N677N
p.N678N
-2.0E-4Trost2022 G
NCOR2     SP0037846 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0037923 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0035799 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0036681 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0032556 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0033571 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0030180 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0032141 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0045838 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0046573 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0044429chr12:
124884993-124884993
ACintronicDe novo--Trost2022 G
NCOR2     SP0045205 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0043673 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0043910chr12:
124884993-124884993
ACintronicDe novo--Trost2022 G
NCOR2     1-0591-003chr12:
124842972-124842985
CTGTGTGTGTGTGTCTGTGTGTGTGTintronicDe novo--Yuen2017 G
NCOR2     SP0040062 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0040468chr12:
124884993-124884993
ACintronicDe novo--Trost2022 G
NCOR2     SP0068802 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0069073 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0068163chr12:
124884993-124884993
ACintronicDe novo--Trost2022 G
NCOR2     SP0068433 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0060538 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0065062 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0050804 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0052849chr12:
124884993-124884993
ACintronicDe novo--Trost2022 G
NCOR2     SP0092935 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0096231 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0084700 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0089004 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     AU2525302chr12:
125192224-125192224
GAintergenicDe novo--Yuen2017 G
NCOR2     SP0081363 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     2-1375-003chr12:
124945891-124945891
GAintronicDe novo--Yuen2016 G
Yuen2017 G
NCOR2     SP0082985 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0075720 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     1-0024-003chr12:
124901632-124901632
GCintronicDe novo--Yuen2017 G
NCOR2     SP0078621 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     12948.p1chr12:
125106918-125106922
CGTACTGCATintergenicInherited--Wilfert2021 G
NCOR2     SP0143965 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0150006 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0134424 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0134999 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0128495chr12:
124884993-124884993
ACintronicDe novo--Trost2022 G
NCOR2     SP0131329 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0111751 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
NCOR2     SP0116126chr12:
124884993-124884993
ACintronicDe novo--Trost2022 G
NCOR2     AU2168301chr12:
124893600-124893600
GAintronicDe novo--Trost2022 G
NCOR2     5-0050-003chr12:
124844096-124844101
TGGAGGTintronicDe novo--Trost2022 G
Yuen2017 G
NCOR2     1031chr12:
124901645-124901645
GCintronicDe novo--Trost2022 G
NCOR2     SP0085418chr12:
124884994-124884994
ACintronicDe novo--Trost2022 G
NCOR2     SP0127375chr12:
124884994-124884994
ACintronicDe novo--Trost2022 G
NCOR2     SP0049292chr12:
124884994-124884994
ACintronicDe novo--Trost2022 G
NCOR2     SP0052527chr12:
124884994-124884994
ACintronicDe novo--Trost2022 G
NCOR2     SP0016841chr12:
124884994-124884994
ACintronicDe novo--Trost2022 G
NCOR2     SP0037507chr12:
124884994-124884994
ACintronicDe novo--Trost2022 G
NCOR2     MSSNG00435-003chr12:
124977510-124977510
CTintronicDe novo--Trost2022 G
NCOR2     MSSNG00117-003chr12:
124979415-124979415
GAintronicDe novo--Trost2022 G
NCOR2     3-0391-000chr12:
124945527-124945527
CTintronicDe novo--Trost2022 G
NCOR2     AU2237301chr12:
124964636-124964636
CTintronicDe novo--Trost2022 G
NCOR2     2-1725-003chr12:
124879884-124879884
GAintronicDe novo--Trost2022 G
Yuen2017 G
NCOR2     REACH000233chr12:
124913229-124913230
CTCintronicDe novo--Trost2022 G
NCOR2     AU3984301chr12:
124923372-124923372
GCintronicDe novo--Trost2022 G
NCOR2     MT_57.3chr12:
124901645-124901645
GCintronicDe novo--Trost2022 G
NCOR2     1-1189-003chr12:
124908837-124908837
TCintronicDe novo--Trost2022 G
NCOR2     4-0039-003chr12:
125024708-125024708
TTGCAAAintronicDe novo--Trost2022 G
NCOR2     AU2504301chr12:
125034833-125034833
GTintronicDe novo--Trost2022 G
NCOR2     MSSNG00006-004chr12:
125009108-125009108
TTCintronicDe novo--Trost2022 G
NCOR2     3-0261-000chr12:
125012652-125012652
GCintronicDe novo--Trost2022 G
NCOR2     MSSNG00042-003chr12:
124988700-124988700
GAintronicDe novo--Trost2022 G
NCOR2     MSSNG00002-003chr12:
124993274-124993274
CTintronicDe novo--Trost2022 G
NCOR2     AU009904chr12:
124892206-124892206
GAintronicDe novo--Trost2022 G
Yuen2017 G
NCOR2     1-0627-003chr12:
125060564-125060564
CTintergenicDe novo--Yuen2017 G
NCOR2     2-0305-004chr12:
125232398-125232398
ACintergenicDe novo--Yuen2017 G
NCOR2     14607.p1chr12:
124831242-124831242
CTexonicDe novosynonymous SNVNM_001077261
NM_001206654
NM_006312
c.G4197A
c.G4197A
c.G4227A
p.P1399P
p.P1399P
p.P1409P
-1.0E-4Iossifov2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wilfert2021 G
Zhou2022 GE
NCOR2     13704.p1chr12:
124887011-124887011
TCexonicDe novononsynonymous SNVNM_001077261
NM_001206654
NM_006312
c.A1576G
c.A1576G
c.A1579G
p.K526E
p.K526E
p.K527E
12.39-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Zhou2022 GE
NCOR2     SSC09043chr12:
124887011-124887011
TCexonicDe novononsynonymous SNVNM_001077261
NM_001206654
NM_006312
c.A1576G
c.A1576G
c.A1579G
p.K526E
p.K526E
p.K527E
12.39-Fu2022 E
Lim2017 E
Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More