or
or
Exact

Results for "ATP2B2"

Variant Events: 72

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ATP2B2     7-0298-004chr3:
10582234-10582234
TGintergenicDe novo--Trost2022 G
ATP2B2     12473.p1chr3:
10384596-10384596
CTexonicDe novosynonymous SNVNM_001683
NM_001001331
c.G2622A
c.G2757A
p.T874T
p.T919T
--Krupp2017 E
Satterstrom2020 E
Zhou2022 GE
ATP2B2     SSC04349chr3:
10384596-10384596
CTexonicDe novosynonymous SNVNM_001683
NM_001001331
c.G2622A
c.G2757A
p.T874T
p.T919T
--Fu2022 E
Trost2022 G
ATP2B2     3-0772-000chr3:
10599567-10599567
GAintergenicDe novo--Trost2022 G
ATP2B2     3-0866-000chr3:
10545751-10545753
CATCintronicDe novo--Trost2022 G
ATP2B2     5-5209-003chr3:
10548544-10548544
GAintergenicDe novo--Trost2022 G
ATP2B2     SSC06567chr3:
10387773-10387773
GAexonicnonsynonymous SNVNM_001683
NM_001001331
c.C2318T
c.C2453T
p.T773M
p.T818M
29.7-Antaki2022 GE
ATP2B2     SP0053792chr3:
10370596-10370596
CTexonicDe novononsynonymous SNVNM_001683
NM_001001331
c.G3499A
c.G3634A
p.A1167T
p.A1212T
29.3-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ATP2B2     SP0109415chr3:
10442711-10442711
ATexonicDe novononsynonymous SNVNM_001001331
NM_001683
c.T707A
c.T707A
p.I236N
p.I236N
27.2-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ATP2B2     SP0042294chr3:
10400608-10400608
ACexonicDe novononsynonymous SNVNM_001683
NM_001001331
c.T1768G
c.T1903G
p.C590G
p.C635G
17.62-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ATP2B2     1-0539-003chr3:
10596093-10596093
CTintergenicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     2-0198-005chr3:
10489508-10489508
TGintronicDe novo--Yuen2017 G
ATP2B2     DEASD_0149_001chr3:
10370499-10370499
TTAAAGCGexonicDe novononframeshift insertionNM_001683
NM_001001331
c.3595_3596insCGCTTT
c.3730_3731insCGCTTT
p.X1199delinsSLX
p.X1244delinsSLX
--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ATP2B2     AU4069301chr3:
10455265-10455265
CAintronicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     1-0484-003chr3:
10407351-10407351
GGTTintronicDe novo--Yuen2017 G
ATP2B2     2-1066-004chr3:
10407486-10407486
AATGintronicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     SP0082834chr3:
10443952-10443952
AGexonicDe novononsynonymous SNVNM_001001331
NM_001683
c.T478C
c.T478C
p.S160P
p.S160P
27.2-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ATP2B2     2-1155-003chr3:
10404551-10404565
CATATATATATATATCATATATATATATintronicDe novo--Yuen2017 G
ATP2B2     JASD_Fam0161chr3:
10381972-10381972
CTexonicDe novostopgainNM_001683
NM_001001331
c.G3056A
c.G3191A
p.W1019X
p.W1064X
45.0-Takata2018 E
ATP2B2     JASD_Fam0257chr3:
10392130-10392130
GTexonicDe novostopgainNM_001683
NM_001001331
c.C2133A
c.C2268A
p.C711X
p.C756X
43.0-Takata2018 E
ATP2B2     AU2100302chr3:
10551865-10551865
TCintergenicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     1-0200-004chr3:
10557704-10557704
GTintergenicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     1-0054-004chr3:
10429858-10429858
CTintronicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     SP0021564chr3:
10417197-10417200
TGAATexonicDe novononframeshift deletionNM_001683
NM_001001331
c.1195_1197del
c.1330_1332del
p.399_399del
p.444_444del
--Fu2022 E
Trost2022 G
Zhou2022 GE
ATP2B2     SP0118518chr3:
10401666-10401666
TCexonicDe novononsynonymous SNVNM_001683
NM_001001331
c.A1666G
c.A1801G
p.T556A
p.T601A
27.1-Fu2022 E
Trost2022 G
Zhou2022 GE
ATP2B2     2-0198-004chr3:
10489508-10489508
TGintronicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     12853.p1chr3:
10387773-10387773
GAexonicDe novononsynonymous SNVNM_001683
NM_001001331
c.C2318T
c.C2453T
p.T773M
p.T818M
29.7-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Trost2022 G
Wilfert2021 G
Zhou2022 GE
ATP2B2     2-1416-004chr3:
10407342-10407342
TTGTTTGTGTGintronicDe novo--Yuen2017 G
ATP2B2     2-0225-004chr3:
10373397-10373397
TTAintronicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     3-0307-000chr3:
10380424-10380424
CTintronicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     1-0380-003chr3:
10530142-10530142
TCintronicDe novo--Yuen2017 G
ATP2B2     2-0171-003chr3:
10489261-10489261
AGintronicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     AU4306302chr3:
10619641-10619641
CTintergenicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     AU3703302chr3:
10385751-10385751
CTintronicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     472-05-104142chr3:
10400378-10400378
TCexonicDe novosynonymous SNVNM_001683
NM_001001331
c.A1998G
c.A2133G
p.P666P
p.P711P
--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ATP2B2     2-1619-004chr3:
10407270-10407271
CAGTATATGTGTGTTGTGTGTTTGTGTintronicDe novo--Trost2022 G
ATP2B2     1-0541-004chr3:
10407323-10407323
ATGintronicDe novo--Trost2022 G
ATP2B2     2-1398-003chr3:
10407270-10407271
CATATGTGTGTTGTGTGTTTGTGTintronicDe novo--Trost2022 G
ATP2B2     1-0271-004chr3:
10407270-10407271
CAGTATATGTGTGTTGTGTGTTTGTGTintronicDe novo--Trost2022 G
ATP2B2     1-0269-003chr3:
10376740-10376740
GAintronicDe novo--Trost2022 G
Yuen2017 G
ATP2B2     More2023:15chr3:
10392216-10392216
GAexonicInheritednonsynonymous SNVNM_001683
NM_001001331
c.C2047T
c.C2182T
p.R683C
p.R728C
28.0-More2023 G
ATP2B2     SP0128684chr3:
10401575-10401575
AGexonicDe novononsynonymous SNVNM_001683
NM_001001331
c.T1757C
c.T1892C
p.V586A
p.V631A
21.8-Trost2022 G
ATP2B2     3-0515-000chr3:
10407270-10407271
CAGTATATGTGTGTTGTGTGTTTGTGTintronicDe novo--Trost2022 G
ATP2B2     SP0154415chr3:
10387166-10387166
GAexonicDe novononsynonymous SNVNM_001683
NM_001001331
c.C2470T
c.C2605T
p.R824C
p.R869C
20.1-Trost2022 G
ATP2B2     MSSNG00013-003chr3:
10396255-10396255
GAintronicDe novo--Trost2022 G
ATP2B2     2-1505-003chr3:
10407337-10407337
CTATGTGTGintronicDe novo--Trost2022 G
ATP2B2     1-0406-003chr3:
10407371-10407371
ATintronicDe novo--Trost2022 G
ATP2B2     2-1467-003chr3:
10407336-10407337
ACGTintronicDe novo--Trost2022 G
ATP2B2     1-0756-003chr3:
10407336-10407338
ACTGGTAGGintronicDe novo--Trost2022 G
ATP2B2     1-0541-004chr3:
10407332-10407332
GGGTGTintronicDe novo--Trost2022 G
ATP2B2     1-0541-004chr3:
10407336-10407337
ACGTGTGTGintronicDe novo--Trost2022 G
ATP2B2     1-0541-004chr3:
10407328-10407328
TTGTGTCintronicDe novo--Trost2022 G
ATP2B2     NDAR_INVTT613RN2_wes1chr3:
10420113-10420113
GAintronicDe novo-0.0251Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
ATP2B2     2-1467-003chr3:
10407331-10407331
AGTTintronicDe novo--Trost2022 G
ATP2B2     1-0406-003chr3:
10407390-10407390
CGintronicDe novo--Trost2022 G
ATP2B2     1-0928-003chr3:
10407394-10407394
GGTGTTintronicDe novo--Trost2022 G
ATP2B2     1-0928-003chr3:
10407389-10407390
TCATGintronicDe novo--Trost2022 G
ATP2B2     2-1401-003chr3:
10407390-10407390
CTintronicDe novo--Trost2022 G
ATP2B2     1-0928-003chr3:
10407382-10407382
CTintronicDe novo--Trost2022 G
ATP2B2     1-0406-003chr3:
10407384-10407384
GGTintronicDe novo--Trost2022 G
ATP2B2     1-0928-003chr3:
10407379-10407379
GGTGTintronicDe novo--Trost2022 G
ATP2B2     2-1093-009chr3:
10407380-10407382
GTCTGTintronicDe novo--Trost2022 G
ATP2B2     1-0555-003chr3:
10434750-10434750
CTintronicDe novo--Trost2022 G
ATP2B2     MT_24.3chr3:
10518811-10518811
CGintronicDe novo--Trost2022 G
ATP2B2     10001071002700288-Cchr3:
10417161-10417161
CTexonicDe novononsynonymous SNVNM_001683
NM_001001331
c.G1234A
c.G1369A
p.E412K
p.E457K
27.5-Fu2022 E
ATP2B2     2-1481-003chr3:
10407496-10407496
TTAGintronicDe novo--Trost2022 G
ATP2B2     12853_p1chr3:
10387773-10387773
GAexonicDe novononsynonymous SNVNM_001683
NM_001001331
c.C2318T
c.C2453T
p.T773M
p.T818M
29.7-Fu2022 E
ATP2B2     4-0075-003chr3:
10429820-10429820
TCintronicDe novo--Trost2022 G
ATP2B2     2-0307-004chr3:
10407417-10407418
GCAAintronicDe novo--Trost2022 G
ATP2B2     5-1009-003chr3:
10407438-10407438
CTAintronicDe novo--Trost2022 G
ATP2B2     2-1401-003chr3:
10407394-10407394
GGTGATGTintronicDe novo--Trost2022 G
ATP2B2     2-1401-003chr3:
10407397-10407397
AGintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More