
Results for "PHLPP1"

Variant Events: 51

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
PHLPP1     2-1342-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
PHLPP1     1-0393-003chr18:
GAintronicDe novo--Trost2022 G
Yuen2017 G
PHLPP1     11194.p1chr18:
AGintergenicDe novo--Turner2016 G
PHLPP1     14015.p1chr18:
CGexonicDe novosynonymous SNVNM_194449c.C159Gp.P53P--Turner2016 G
PHLPP1     12529.p1chr18:
TGintronicDe novo--Turner2016 G
PHLPP1     1-0606-003chr18:
AGintergenicDe novo--Yuen2017 G
PHLPP1     7-0024-005chr18:
CAintergenicDe novo--Yuen2017 G
PHLPP1     1-0604-003chr18:
GAintronicDe novo--Yuen2017 G
PHLPP1     5-0128-003chr18:
GTAGATAGTAintronicDe novo--Yuen2017 G
PHLPP1     1-0564-003chr18:
PHLPP1     7-0123-003chr18:
GCTCTGCTintronicDe novo--Yuen2017 G
PHLPP1     74-0075chr18:
TAintergenicDe novo--Michaelson2012 G
PHLPP1     1-0402-004chr18:
GAintergenicDe novo--Yuen2017 G
PHLPP1     1-0153-004chr18:
GCintronicDe novo--Yuen2017 G
PHLPP1     AU3874301chr18:
TCintronicDe novo--Trost2022 G
Yuen2017 G
PHLPP1     1-0559-004chr18:
GAintergenicDe novo--Yuen2017 G
PHLPP1     151454chr18:
CTexonicDe novosynonymous SNVNM_194449c.C408Tp.A136A--Fu2022 E
PHLPP1     More2023:7chr18:
ACAexonicDe novoframeshift deletionNM_194449c.1872delCp.Y624fs--More2023 G
PHLPP1     AU073005chr18:
CTintronicDe novo--Trost2022 G
Yuen2017 G
PHLPP1     4-0073-003chr18:
CAGTAAintronicDe novo--Trost2022 G
PHLPP1     MT_166.3chr18:
TCintronicDe novo--Trost2022 G
PHLPP1     9-0027-003chr18:
TCintronicDe novo--Trost2022 G
PHLPP1     4-0062-003chr18:
CAGTAAintronicDe novo--Trost2022 G
PHLPP1     AU1355301chr18:
TCintronicDe novo--Trost2022 G
Yuen2017 G
PHLPP1     AU2165301chr18:
CTintronicDe novo--Trost2022 G
Yuen2017 G
PHLPP1     SP0218140chr18:
GAexonicDe novosynonymous SNVNM_194449c.G813Ap.L271L--Trost2022 G
PHLPP1     SP0039062chr18:
PHLPP1     1-0153-004Achr18:
GCintronicDe novo--Trost2022 G
PHLPP1     AU2577301chr18:
TAintronicDe novo--Trost2022 G
PHLPP1     2-1106-004chr18:
TGTintronicDe novo--Trost2022 G
PHLPP1     AU2000302chr18:
GAintronicDe novo--Trost2022 G
Yuen2017 G
PHLPP1     2-1562-003chr18:
ATGTCTAGCGCCCGintronicDe novo--Trost2022 G
PHLPP1     3-0497-000chr18:
ATGTCTAGCGCCCGintronicDe novo--Trost2022 G
PHLPP1     1-0402-004chr18:
TCintronicDe novo--Trost2022 G
PHLPP1     3-0497-001chr18:
ATGTCTAGCGCCCGintronicDe novo--Trost2022 G
PHLPP1     3-0402-000chr18:
TAintronicDe novo--Trost2022 G
PHLPP1     1-0402-004chr18:
TCintronicDe novo--Trost2022 G
PHLPP1     13861.p1chr18:
CCGGCGGCCGCCGCTGCGGCAGCAGCAGCAGCAGCGGCGGCCGCexonicnonframeshift deletionNM_194449c.71_112delp.24_38del--Zhou2022 GE
PHLPP1     AU3724301chr18:
GAGintergenicDe novo--Yuen2017 G
PHLPP1     11146.p1chr18:
GAexonicnonsynonymous SNVNM_194449c.G4501Ap.G1501R8.2059.369E-6Zhou2022 GE
PHLPP1     2-1398-004chr18:
AATTintronicDe novo--Trost2022 G
PHLPP1     5-5209-003chr18:
CTexonicDe novononsynonymous SNVNM_194449c.C320Tp.A107V11.2-Trost2022 G
Zhou2022 GE
PHLPP1     2-1294-003chr18:
CTintronicDe novo--Trost2022 G
PHLPP1     1-0636-003chr18:
AGintergenicDe novo--Yuen2017 G
PHLPP1     5-1001-003chr18:
TCintronicDe novo--Trost2022 G
PHLPP1     MSSNG00254-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
PHLPP1     AU1952305chr18:
GTintronicDe novo--Trost2022 G
Yuen2017 G
PHLPP1     AU2139303chr18:
GCintronicDe novo--Trost2022 G
Yuen2017 G
PHLPP1     1-1054-003chr18:
CTintronicDe novo--Trost2022 G
PHLPP1     MSSNG00169-003chr18:
AGintronicDe novo--Trost2022 G
PHLPP1     A30chr18:
TCintronicDe novo--Wu2018 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView