or
or
Exact

Results for "ANKRD27"

Variant Events: 21

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ANKRD27     mAGRE5305chr19:
33137338-33137366
AGAAAAAGGTTTTTTCTCCCAGAATACCTAexonicPaternalframeshift deletionNM_032139c.369_370delp.S123fs-1.706E-5Cirnigliaro2023 G
ANKRD27     2-1116-003chr19:
33135432-33135432
TAintronicDe novo--Yuen2016 G
ANKRD27     mAGRE4277chr19:
33095277-33095277
CCTCGTGCAGCGCTGTGTTGCCCTTATTexonicMaternalframeshift insertionNM_032139c.2546_2547insAATAAGGGCAACACAGCGCTGCACGAp.E849fs-1.0E-4Cirnigliaro2023 G
ANKRD27     3-0183-000chr19:
33165814-33165814
GAintronicDe novo--Trost2022 G
Trost2022 G
ANKRD27     mAGRE2472chr19:
33095277-33095277
CCTCGTGCAGCGCTGTGTTGCCCTTATTexonicPaternalframeshift insertionNM_032139c.2546_2547insAATAAGGGCAACACAGCGCTGCACGAp.E849fs-1.0E-4Cirnigliaro2023 G
ANKRD27     AU3918302chr19:
33095277-33095277
CCTCGTGCAGCGCTGTGTTGCCCTTATTexonicMaternalframeshift insertionNM_032139c.2546_2547insAATAAGGGCAACACAGCGCTGCACGAp.E849fs-1.0E-4Cirnigliaro2023 G
ANKRD27     MSSNG00392-003chr19:
33096183-33096183
TCintronicDe novo--Trost2022 G
ANKRD27     AU3638302chr19:
33111263-33111263
AGintronicDe novo--Trost2022 G
ANKRD27     AU1687303chr19:
33091088-33091088
AGintronicDe novo--Yuen2017 G
ANKRD27     11431.p1chr19:
33113320-33113331
AGAGCTACCTTTAexonicDe novoframeshift deletionNM_032139c.1824_1827delp.S608fs--Wilfert2021 G
Zhou2022 GE
ANKRD27     1483JS0011chr19:
33135343-33135343
AGexonicDe novononsynonymous SNVNM_032139c.T413Cp.I138T24.44.0E-4DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ANKRD27     PN400474chr19:
33149861-33149861
GAexonicUnknownnonsynonymous SNVNM_032139c.C61Tp.R21C19.30.0052Leblond2019 E
ANKRD27     Kim2020:B21chr19:
33119026-33119026
GCexonicDe novononsynonymous SNVNM_032139c.C1383Gp.D461E21.0-Kim2020 E
ANKRD27     AU1687302chr19:
33091088-33091088
AGintronicDe novo--Trost2022 G
Yuen2017 G
ANKRD27     Chen2017:71chr19:
33135343-33135343
AGexonicDe novononsynonymous SNVNM_032139c.T413Cp.I138T24.44.0E-4Chen2017 E
ANKRD27     AU2734301chr19:
33135343-33135343
AGexonicnonsynonymous SNVNM_032139c.T413Cp.I138T24.44.0E-4Zhou2022 GE
ANKRD27     SP0124694chr19:
33134216-33134216
CTexonicDe novononsynonymous SNVNM_032139c.G682Ap.V228M14.311.649E-5Fu2022 E
Trost2022 G
Zhou2022 GE
ANKRD27     iHART2472chr19:
33095277-33095277
CCTCGTGCAGCGCTGTGTTGCCCTTATTexonicPaternalframeshift insertionNM_032139c.2546_2547insAATAAGGGCAACACAGCGCTGCACGAp.E849fs-1.0E-4Ruzzo2019 G
ANKRD27     11002.p1chr19:
33091980-33091980
GAintronicDe novo--Turner2016 G
ANKRD27     PN400325chr19:
33149861-33149861
GAexonicUnknownnonsynonymous SNVNM_032139c.C61Tp.R21C19.30.0052Leblond2019 E
ANKRD27     08C76427chr19:
33135343-33135343
AGexonicDe novononsynonymous SNVNM_032139c.T413Cp.I138T24.44.0E-4Satterstrom2020 E
Trost2022 G
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More