or
or
Exact

Results for "SNTG1"

Variant Events: 79

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SNTG1     7-0068-003chr8:
51667075-51667075
TCintronicDe novo--Yuen2017 G
SNTG1     11471.p1chr8:
51306875-51306875
GAintronicDe novo-1.68E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
SNTG1     2-0244-003chr8:
50841670-50841670
AGintronicDe novo--Yuen2017 G
SNTG1     AU3906301chr8:
50838635-50838635
TCintronicDe novo--Yuen2017 G
SNTG1     AU4242302chr8:
51871104-51871104
TCintergenicDe novo--Yuen2017 G
SNTG1     1-0593-003chr8:
51714882-51714882
AGintergenicDe novo--Yuen2017 G
SNTG1     1-1000-003chr8:
51598510-51598525
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintronicDe novo--Yuen2017 G
SNTG1     1-0469-005chr8:
50986016-50986016
CTintronicDe novo--Yuen2017 G
SNTG1     2-0305-003chr8:
52153963-52153963
AATAAAGintergenicDe novo--Yuen2017 G
SNTG1     NDAR_INVZW891AN2_wes1chr8:
51314822-51314822
TCexonicDe novononsynonymous SNVNM_001287814
NM_018967
NM_001287813
c.T80C
c.T80C
c.T80C
p.V27A
p.V27A
p.V27A
18.05-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
SNTG1     1-0541-003chr8:
51612097-51612097
AGintronicDe novo--Yuen2017 G
SNTG1     AU1404301chr8:
52170419-52170419
ATintergenicDe novo--Yuen2017 G
SNTG1     09C89530chr8:
51705253-51705253
TAexonicDe novononsynonymous SNVNM_001287814
NM_018967
NM_001287813
c.T1307A
c.T1418A
c.T1418A
p.F436Y
p.F473Y
p.F473Y
15.358.264E-6DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Neale2012 E
Satterstrom2020 E
SNTG1     1-0661-003chr8:
52203219-52203219
GTintergenicDe novo--Yuen2017 G
SNTG1     2-1275-003chr8:
51462939-51462939
AGintronicDe novo--Yuen2017 G
SNTG1     AU070703chr8:
51827280-51827280
GCintergenicDe novo--Yuen2017 G
SNTG1     AU3787302chr8:
50937187-50937187
TCintronicDe novo--Yuen2017 G
SNTG1     1-0196-005chr8:
52071781-52071781
CAintergenicDe novo--Yuen2017 G
SNTG1     2-0057-003chr8:
51281285-51281285
GAintronicDe novo--Yuen2017 G
SNTG1     2-1521-003chr8:
51764716-51764729
GTATATATATATATGTATATATATATintergenicDe novo--Yuen2017 G
SNTG1     AU072004chr8:
52158175-52158175
ACintergenicDe novo--Yuen2017 G
SNTG1     AU3874301chr8:
51555802-51555802
TGintronicDe novo--Yuen2017 G
SNTG1     11835.p1chr8:
51580738-51580741
TTTGTintronicDe novo--Wilfert2021 G
SNTG1     1-0835-003chr8:
51323880-51323880
CTintronicDe novo--Yuen2017 G
SNTG1     2-0202-003chr8:
52149997-52149997
TCintergenicDe novo--Yuen2017 G
SNTG1     AU079204chr8:
51571449-51571449
CTintronicDe novo--Yuen2017 G
SNTG1     AU4188302chr8:
51919033-51919033
ATintergenicDe novo--Yuen2017 G
SNTG1     AU3634301chr8:
51846866-51846866
TCintergenicDe novo--Yuen2017 G
SNTG1     1-0336-004chr8:
51353274-51353274
AGintronicDe novo--Yuen2017 G
SNTG1     1-0336-004chr8:
50974435-50974435
GTintronicDe novo--Yuen2017 G
SNTG1     2-0129-004chr8:
51025632-51025632
GTintronicDe novo--Yuen2017 G
SNTG1     1-0169-003chr8:
51658686-51658686
GAintronicDe novo--Yuen2017 G
SNTG1     AU3907302chr8:
51297139-51297139
AGintronicDe novo--Yuen2017 G
SNTG1     1-0289-004chr8:
51898553-51898553
AAGATCintergenicDe novo--Yuen2017 G
SNTG1     1-0417-003chr8:
51042095-51042095
AGintronicDe novo--Yuen2016 G
Yuen2017 G
SNTG1     AU4079301chr8:
51642554-51642554
GAintronicDe novo--Yuen2017 G
SNTG1     09C90753Achr8:
51617300-51617300
ATexonicDe novosynonymous SNVNM_001287814
NM_018967
NM_001287813
c.A1179T
c.A1179T
c.A1179T
p.V393V
p.V393V
p.V393V
-6.0E-4Satterstrom2020 E
SNTG1     2-1594-003chr8:
51117209-51117209
CTintronicDe novo--Yuen2017 G
SNTG1     1-0508-003chr8:
51127471-51127471
GAintronicDe novo--Yuen2017 G
SNTG1     5-0117-003chr8:
51027806-51027806
AGintronicDe novo--Yuen2017 G
SNTG1     1-0495-003chr8:
51837659-51837659
AGintergenicDe novo--Yuen2017 G
SNTG1     1-0936-003chr8:
50962500-50962500
CTintronicDe novo--Yuen2017 G
SNTG1     2-1196-003chr8:
51211386-51211386
CTintronicDe novo--Yuen2016 G
Yuen2017 G
SNTG1     AU3811305chr8:
51436280-51436280
AGintronicDe novo--Yuen2017 G
SNTG1     1-0745-003chr8:
51321801-51321801
TAintronicDe novo--Yuen2017 G
SNTG1     1-0531-003chr8:
52086098-52086098
GAintergenicDe novo--Yuen2016 G
SNTG1     AU4233301chr8:
51856764-51856764
TGintergenicDe novo--Yuen2017 G
SNTG1     2-1398-003chr8:
51827276-51827278
CAGCintergenicDe novo--Yuen2017 G
SNTG1     3A550chr8:
51503450-51503450
CTexonicDe novosynonymous SNVNM_001287814
NM_018967
NM_001287813
c.C822T
c.C822T
c.C822T
p.I274I
p.I274I
p.I274I
--Satterstrom2020 E
SNTG1     1-0433-004chr8:
51046124-51046124
ATintronicDe novo--Yuen2017 G
SNTG1     1-0372-003chr8:
51713092-51713092
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
SNTG1     2-1183-003chr8:
51931779-51931779
TCintergenicDe novo--Yuen2017 G
SNTG1     1-0483-003chr8:
51066348-51066348
CGintronicDe novo--Yuen2016 G
Yuen2017 G
SNTG1     2-0503-004chr8:
50851171-50851171
CCTintronicDe novo--Yuen2017 G
SNTG1     1-0186-005chr8:
52171993-52171993
CAintergenicDe novo--Yuen2017 G
SNTG1     2-1696-003chr8:
51453296-51453296
CTintronicDe novo--Yuen2017 G
SNTG1     2-1132-003chr8:
50893754-50893755
ACAintronicDe novo--Yuen2017 G
SNTG1     AU4468301chr8:
51054377-51054377
GCintronicDe novo--Yuen2017 G
SNTG1     1-0674-004chr8:
51529288-51529288
TAintronicDe novo--Yuen2017 G
SNTG1     1-0408-003chr8:
51815225-51815225
GAintergenicDe novo--Yuen2017 G
SNTG1     13649.p1chr8:
51128955-51128955
AGintronicDe novo--Turner2016 G
SNTG1     2-0299-005chr8:
51579079-51579079
CGintronicDe novo--Yuen2017 G
SNTG1     2-1567-003chr8:
51652732-51652732
GAintronicDe novo--Yuen2017 G
SNTG1     AU3124302chr8:
51900863-51900863
ATintergenicDe novo--Yuen2017 G
SNTG1     2-1279-003chr8:
51811199-51811199
CTintergenicDe novo--Yuen2017 G
SNTG1     AU4378301chr8:
52015161-52015161
TGintergenicDe novo--Yuen2017 G
SNTG1     AU3839303chr8:
50953724-50953724
GTintronicDe novo--Yuen2017 G
SNTG1     1-0384-003chr8:
52094249-52094249
GAintergenicDe novo--Yuen2017 G
SNTG1     1-0466-003chr8:
50957516-50957516
CAintronicDe novo--Yuen2017 G
SNTG1     AU4145303chr8:
51229418-51229418
GAintronicDe novo--Yuen2017 G
SNTG1     AU039304chr8:
51897743-51897743
TAintergenicDe novo--Yuen2017 G
SNTG1     2-1363-003chr8:
51474935-51474935
TAintronicDe novo--Yuen2016 G
Yuen2017 G
SNTG1     2-1529-003chr8:
51480161-51480161
AGintronicDe novo--Yuen2017 G
SNTG1     2-1375-003chr8:
51952487-51952487
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
SNTG1     2-0135-004chr8:
51304839-51304839
TCintronicDe novo--Yuen2017 G
SNTG1     1-0509-003chr8:
51283499-51283499
GTintronicDe novo--Yuen2016 G
Yuen2017 G
SNTG1     2-1421-003chr8:
51209562-51209562
CGintronicDe novo--Yuen2016 G
Yuen2017 G
SNTG1     1-1004-003chr8:
51051262-51051262
TCintronicDe novo--Yuen2017 G
SNTG1     AU3888302chr8:
51509039-51509039
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More