or
or
Exact

Results for "CERS6"

Variant Events: 23

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CERS6     7-0168-003chr2:
169529145-169529145
AGintronicDe novo--Yuen2017 G
CERS6     12449.p1chr2:
169446196-169446196
AGintronicDe novo--Turner2016 G
CERS6     1-0874-003chr2:
169354293-169354293
AGintronicDe novo--Yuen2017 G
CERS6     2-1738-003chr2:
169433608-169433608
GAintronicDe novo--Yuen2017 G
CERS6     1-0998-003chr2:
169543297-169543297
GAintronicDe novo--Yuen2017 G
CERS6     11962.p1chr2:
169417831-169417831
AGexonicDe novononsynonymous SNVNM_001256126
NM_203463
c.A406G
c.A406G
p.M136V
p.M136V
4.5241.649E-5Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Sanders2012 E
Satterstrom2020 E
CERS6     7-0166-003chr2:
169388908-169388908
TCintronicDe novo--Yuen2017 G
CERS6     133343chr2:
169551553-169551553
ACexonicnonsynonymous SNVNM_001256126
NM_203463
c.A601C
c.A601C
p.K201Q
p.K201Q
21.3-Woodbury-Smith2022 E
CERS6     AU050403chr2:
169423600-169423600
ACintronicDe novo--Yuen2017 G
CERS6     1-0079-003chr2:
169599113-169599113
TCintronicDe novo--Yuen2017 G
CERS6     1-0558-003chr2:
169363546-169363561
CTGTGTGTGTGTGTGTCTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
CERS6     2-0149-003chr2:
169434278-169434278
AGintronicDe novo--Yuen2017 G
CERS6     SSC03560chr2:
169417831-169417831
AGexonicDe novononsynonymous SNVNM_001256126
NM_203463
c.A406G
c.A406G
p.M136V
p.M136V
4.5241.649E-5Lim2017 E
CERS6     1-0173-004chr2:
169388362-169388362
CGintronicDe novo--Yuen2017 G
CERS6     2-0158-003chr2:
169515534-169515534
CGintronicDe novo--Yuen2017 G
CERS6     10C102633Achr2:
169626279-169626285
AATTAAGAUTR3De novo--Neale2012 E
CERS6     2-0158-003chr2:
169478317-169478317
CGintronicDe novo--Yuen2017 G
CERS6     08C72791chr2:
169547610-169547610
TCintronicDe novo--Satterstrom2020 E
CERS6     AU2123301chr2:
169345112-169345112
GAintronicDe novo--Yuen2017 G
CERS6     7-0100-003chr2:
169425180-169425180
GAintronicDe novo--Yuen2017 G
CERS6     5-0055-004chr2:
169370487-169370487
AGintronicDe novo--Yuen2017 G
CERS6     5-0138-003chr2:
169561159-169561159
CGintronicDe novo--Yuen2017 G
CERS6     AU078503chr2:
169388532-169388532
GTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More