or
or
Exact

Results for "CTTNBP2"

Variant Events: 109

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CTTNBP2     M32001chr7:
117385943-117385947
TCTCATexonicDe novoframeshift deletionNM_033427c.3473_3476delp.V1158fs--Guo2018 T
CTTNBP2     2-1511-003chr7:
117550169-117550188
AAAATAAATAAATAAATAAAAAAATAAATAAATAAAintergenicDe novo--Yuen2017 G
CTTNBP2     Stessman2017:ASD-1627chr7:
117385986-117385986
TGsplicingInheritedsplicing21.7-Stessman2017 T
CTTNBP2     M16163chr7:
117368308-117368308
GAexonicMaternalnonsynonymous SNVNM_033427c.C3890Tp.A1297V0.112.496E-5Guo2018 T
CTTNBP2     M18461chr7:
117420501-117420501
TAexonicMaternalnonsynonymous SNVNM_033427c.A2517Tp.K839N14.49-Guo2018 T
CTTNBP2     M19799chr7:
117400660-117400660
GAexonicMaternalnonsynonymous SNVNM_033427c.C3001Tp.R1001C23.57.415E-5Guo2018 T
CTTNBP2     PN400367chr7:
117358150-117358150
TTAAATCATCCCTGGAATCAGexonicUnknownstopgainNM_033427c.4667_4668insCTGATTCCAGGGATGATTTp.L1556_R1557delinsFX--Leblond2019 E
CTTNBP2     AU3053301chr7:
117410679-117410679
GAintronicDe novo--Yuen2017 G
CTTNBP2     M12513chr7:
117451018-117451018
TCexonicMaternalnonsynonymous SNVNM_033427c.A215Gp.Q72R26.98.265E-6Guo2018 T
CTTNBP2     M08428chr7:
117432154-117432154
TAexonicMaternalnonsynonymous SNVNM_033427c.A1096Tp.I366F5.7411.647E-5Guo2018 T
CTTNBP2     11030.p1chr7:
117662307-117662308
GAGintergenicDe novo--Werling2018 G
CTTNBP2     M12382chr7:
117431493-117431493
GAexonicMaternalnonsynonymous SNVNM_033427c.C1757Tp.S586L13.328.239E-6Guo2018 T
CTTNBP2     M15081chr7:
117420581-117420581
GAexonicMaternalnonsynonymous SNVNM_033427c.C2437Tp.P813S21.88.254E-6Guo2018 T
CTTNBP2     M31980chr7:
117417690-117417692
CAACexonicDe novoframeshift deletionNM_033427c.2651_2652delp.F884fs--Guo2018 T
CTTNBP2     M15212chr7:
117431731-117431731
GAexonicMaternalnonsynonymous SNVNM_033427c.C1519Tp.P507S8.114-Guo2018 T
CTTNBP2     M27823chr7:
117431557-117431557
CTexonicMaternalnonsynonymous SNVNM_033427c.G1693Ap.V565I13.87-Guo2018 T
CTTNBP2     HN0016.p1chr7:
117417690-117417692
CAACexonicMaternalframeshift deletionNM_033427c.2651_2652delp.F884fs--Guo2018 T
CTTNBP2     AU4483301chr7:
117455993-117455993
CGintronicDe novo--Yuen2017 G
CTTNBP2     13918.p1chr7:
117652220-117652220
GGAintergenicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
CTTNBP2     AU4173301chr7:
117763443-117763443
AGintergenicDe novo--Yuen2017 G
CTTNBP2     GX0131.p1chr7:
117420557-117420557
CAexonicPaternalstopgainNM_033427c.G2461Tp.G821X38.0-Guo2018 T
CTTNBP2     GX0225.p1chr7:
117351768-117351769
ACAexonicPaternalframeshift deletionNM_033427c.4814delGp.G1605fs--Guo2018 T
CTTNBP2     AU050604chr7:
117816835-117816835
TCintergenicDe novo--Yuen2017 G
CTTNBP2     GX0233.p1chr7:
117420573-117420573
GCexonicPaternalstopgainNM_033427c.C2445Gp.Y815X36.0-Guo2018 T
CTTNBP2     GX0187.p1chr7:
117361174-117361175
ATAexonicPaternalframeshift deletionNM_033427c.4457delAp.N1486fs--Guo2018 T
CTTNBP2     2-1581-003chr7:
117584489-117584489
CTintergenicDe novo--Yuen2017 G
CTTNBP2     1-0330-003chr7:
117646455-117646456
TGTintergenicDe novo--Yuen2017 G
CTTNBP2     M08434chr7:
117385918-117385918
TCexonicUnknownnonsynonymous SNVNM_033427c.A3502Gp.K1168E22.6-Guo2018 T
CTTNBP2     M19802chr7:
117422931-117422931
GAexonicPaternal, Unknownnonsynonymous SNVNM_033427c.C2357Tp.A786V25.4-Guo2018 T
Stessman2017 T
CTTNBP2     GX0054.p1chr7:
117407211-117407211
CAexonicPaternalnonsynonymous SNVNM_033427c.G2798Tp.C933F22.6-Guo2018 T
CTTNBP2     JS0056.p1chr7:
117431814-117431814
CTexonicPaternalnonsynonymous SNVNM_033427c.G1436Ap.R479H20.89.884E-5Guo2018 T
CTTNBP2     M30901chr7:
117400525-117400525
CTexonicPaternalnonsynonymous SNVNM_033427c.G3136Ap.G1046S18.495.771E-5Guo2018 T
CTTNBP2     HEN0251.p1chr7:
117431443-117431443
GCexonicPaternalnonsynonymous SNVNM_033427c.C1807Gp.L603V2.019-Guo2018 T
CTTNBP2     SX0012.p1chr7:
117368250-117368250
AACexonicMaternalframeshift insertionNM_033427c.3947dupGp.R1316fs-4.123E-5Guo2018 T
CTTNBP2     M30790chr7:
117432661-117432661
CTexonicPaternalnonsynonymous SNVNM_033427c.G589Ap.A197T4.9562.471E-5Guo2018 T
CTTNBP2     HN0137.p1chr7:
117432661-117432661
CTexonicPaternalnonsynonymous SNVNM_033427c.G589Ap.A197T4.9562.471E-5Guo2018 T
CTTNBP2     2-1131-003chr7:
117548211-117548211
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
CTTNBP2     AU3517301chr7:
117607025-117607035
GACACACACACGACACACACintergenicDe novo--Yuen2017 G
CTTNBP2     M32940chr7:
117417690-117417692
CAACexonicMaternalframeshift deletionNM_033427c.2651_2652delp.F884fs--Guo2018 T
CTTNBP2     M32047chr7:
117431668-117431668
TCexonicPaternalnonsynonymous SNVNM_033427c.A1582Gp.S528G8.646-Guo2018 T
CTTNBP2     SD0003.p1chr7:
117432661-117432661
CTexonicPaternalnonsynonymous SNVNM_033427c.G589Ap.A197T4.9562.471E-5Guo2018 T
CTTNBP2     AU1067302chr7:
117501328-117501328
GAexonicUnknownnonsynonymous SNVNM_033427c.C124Tp.R42W23.61.0E-4Stessman2017 T
CTTNBP2     HN0079.p1chr7:
117368165-117368165
CTexonicPaternalnonsynonymous SNVNM_033427c.G4033Ap.G1345R23.18.292E-6Guo2018 T
CTTNBP2     M23107chr7:
117368165-117368165
CTexonicPaternal, Unknownnonsynonymous SNVNM_033427c.G4033Ap.G1345R23.18.292E-6Guo2018 T
Stessman2017 T
CTTNBP2     GX0120.p1chr7:
117364646-117364646
GAexonicPaternalnonsynonymous SNVNM_033427c.C4402Tp.R1468C14.435.774E-5Guo2018 T
CTTNBP2     HN0099.p1chr7:
117385890-117385890
CAexonicPaternalnonsynonymous SNVNM_033427c.G3530Tp.S1177I15.488.262E-5Guo2018 T
CTTNBP2     GX0425.p1chr7:
117368299-117368299
GCexonicPaternalnonsynonymous SNVNM_033427c.C3899Gp.P1300R18.171.0E-4Guo2018 T
CTTNBP2     2-0208-003chr7:
117599446-117599446
CGintergenicDe novo--Yuen2017 G
CTTNBP2     HEN0307.p1chr7:
117368250-117368250
AACexonicMaternalframeshift insertionNM_033427c.3947dupGp.R1316fs-4.123E-5Guo2018 T
CTTNBP2     AU3451301chr7:
117522541-117522541
ACintergenicDe novo--Yuen2017 G
CTTNBP2     iHART2643chr7:
117364788-117364788
TCsplicingPaternalsplicing13.02-Ruzzo2019 G
CTTNBP2     iHART1048chr7:
117361132-117361134
CAGCexonicMaternalframeshift deletionNM_033427c.4498_4499delp.L1500fs--Ruzzo2019 G
CTTNBP2     iHART2644chr7:
117364788-117364788
TCsplicingPaternalsplicing13.02-Ruzzo2019 G
CTTNBP2     AU072505chr7:
117505456-117505456
TGintronicDe novo--Yuen2017 G
CTTNBP2     2-0129-005chr7:
117508598-117508598
CTintronicDe novo--Yuen2017 G
CTTNBP2     13070.p1 Complex Event; expand row to view variants  De novoframeshift deletionNM_033427
NM_033427
c.2279_2280del
c.2278_2279del
p.V760fs
p.V760fs
--Dong2014 E
Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2014 T
Satterstrom2020 E
Wilfert2021 G
Willsey2013 E
CTTNBP2     AU1446301chr7:
117386142-117386142
ACexonicMaternalstopgainNM_033427c.T3360Gp.Y1120X37.0-Stessman2017 T
CTTNBP2     5-0018-003chr7:
117492914-117492914
ACintronicDe novo--Yuen2017 G
CTTNBP2     M20562chr7:
117368228-117368228
GAexonicMaternalnonsynonymous SNVNM_033427c.C3970Tp.R1324C32.04.123E-5Wang2016 T
CTTNBP2     2-1693-003chr7:
117581222-117581222
GAintergenicDe novo--Yuen2017 G
CTTNBP2     211-5657-3chr7:
117375031-117375031
CTexonicUnknownnonsynonymous SNVNM_033427c.G3812Ap.R1271Q33.01.653E-5Stessman2017 T
CTTNBP2     GX0184.p1chr7:
117368165-117368165
CTexonicMaternalnonsynonymous SNVNM_033427c.G4033Ap.G1345R23.18.292E-6Guo2018 T
CTTNBP2     GX0206.p1chr7:
117359610-117359610
AGexonicMaternalnonsynonymous SNVNM_033427c.T4592Cp.V1531A18.06-Guo2018 T
CTTNBP2     GX0094.p1chr7:
117431485-117431485
ATexonicMaternalnonsynonymous SNVNM_033427c.T1765Ap.S589T12.298.239E-6Guo2018 T
CTTNBP2     GX0038.p1chr7:
117385890-117385890
CAexonicMaternalnonsynonymous SNVNM_033427c.G3530Tp.S1177I15.488.262E-5Guo2018 T
CTTNBP2     M08781chr7:
117361145-117361145
CTexonicDe novononsynonymous SNVNM_033427c.G4487Ap.R1496K11.2-Guo2018 T
CTTNBP2     GX0318.p1chr7:
117358153-117358153
ACexonicMaternalnonsynonymous SNVNM_033427c.T4665Gp.D1555E15.913.495E-5Guo2018 T
CTTNBP2     GX0448.p1chr7:
117432327-117432327
TCexonicMaternalnonsynonymous SNVNM_033427c.A923Gp.Q308R17.65-Guo2018 T
CTTNBP2     HN0093.p1chr7:
117431485-117431485
ATexonicMaternalnonsynonymous SNVNM_033427c.T1765Ap.S589T12.298.239E-6Guo2018 T
CTTNBP2     GX0232.p1chr7:
117432593-117432593
TGexonicMaternalnonsynonymous SNVNM_033427c.A657Cp.R219S15.058.258E-6Guo2018 T
CTTNBP2     AU2215302chr7:
117717379-117717379
TCintergenicDe novo--Yuen2017 G
CTTNBP2     HN0051.p1chr7:
117432411-117432411
GCexonicMaternalnonsynonymous SNVNM_033427c.C839Gp.S280C15.074.942E-5Guo2018 T
CTTNBP2     1-0835-003chr7:
117383123-117383123
TCintronicDe novo--Yuen2017 G
CTTNBP2     03C14363chr7:
117361133-117361135
AGAAexonicMaternalframeshift deletionNM_033427c.4497_4498delp.S1499fs--Stessman2017 T
CTTNBP2     J7S7Zchr7:
117365294-117365296
CACCexonicInheritedframeshift deletionNM_033427c.4071_4072delp.L1357fs--Stessman2017 T
CTTNBP2     M23828chr7:
117368228-117368228
GAexonicPaternalnonsynonymous SNVNM_033427c.C3970Tp.R1324C32.04.123E-5Wang2016 T
CTTNBP2     P4N4Wchr7:
117358155-117358155
CAexonicUnknownnonsynonymous SNVNM_033427c.G4663Tp.D1555Y22.05.268E-5Stessman2017 T
CTTNBP2     2-1335-004chr7:
117575408-117575408
TGintergenicDe novo--Yuen2017 G
CTTNBP2     M27803chr7:
117420520-117420520
CTexonicPaternalnonsynonymous SNVNM_033427c.G2498Ap.G833E23.0-Guo2018 T
CTTNBP2     M15123chr7:
117397991-117397991
GAexonicPaternalnonsynonymous SNVNM_033427c.C3206Tp.A1069V5.3023.549E-5Guo2018 T
CTTNBP2     M19563chr7:
117431239-117431239
CTexonicPaternalnonsynonymous SNVNM_033427c.G2011Ap.V671I11.262.473E-5Guo2018 T
CTTNBP2     M20638chr7:
117423010-117423010
CTexonicPaternalnonsynonymous SNVNM_033427c.G2278Ap.V760M22.0-Guo2018 T
CTTNBP2     M12468chr7:
117375088-117375088
GAexonicPaternalnonsynonymous SNVNM_033427c.C3755Tp.A1252V19.59-Guo2018 T
CTTNBP2     M08674chr7:
117361145-117361145
CTexonicPaternalnonsynonymous SNVNM_033427c.G4487Ap.R1496K11.2-Guo2018 T
CTTNBP2     M30841chr7:
117396685-117396685
GAexonicPaternalnonsynonymous SNVNM_033427c.C3272Tp.P1091L11.38-Guo2018 T
CTTNBP2     M08494chr7:
117386114-117386114
CTexonicPaternalnonsynonymous SNVNM_033427c.G3388Ap.G1130R26.9-Guo2018 T
CTTNBP2     14015.p1chr7:
117752577-117752577
CGintergenicDe novo--Turner2016 G
CTTNBP2     M20709chr7:
117432183-117432183
ATexonicPaternalnonsynonymous SNVNM_033427c.T1067Ap.I356N9.516-Guo2018 T
CTTNBP2     M23062chr7:
117432090-117432090
CTexonicPaternalnonsynonymous SNVNM_033427c.G1160Ap.S387N12.61-Guo2018 T
CTTNBP2     M16097chr7:
117450932-117450932
TCexonicPaternalnonsynonymous SNVNM_033427c.A301Gp.K101E17.972.472E-5Guo2018 T
CTTNBP2     M26781chr7:
117432453-117432453
AGexonicPaternalnonsynonymous SNVNM_033427c.T797Cp.I266T12.162.0E-4Guo2018 T
CTTNBP2     M13281chr7:
117431979-117431979
GCexonicPaternalnonsynonymous SNVNM_033427c.C1271Gp.P424R6.1138.236E-6Guo2018 T
CTTNBP2     M15021chr7:
117431352-117431352
GAexonicPaternalnonsynonymous SNVNM_033427c.C1898Tp.T633M20.4-Guo2018 T
CTTNBP2     M08976chr7:
117432061-117432061
TCexonicPaternalnonsynonymous SNVNM_033427c.A1189Gp.S397G0.89-Guo2018 T
CTTNBP2     M12414chr7:
117431979-117431979
GC/GexonicPaternal--Guo2018 T
CTTNBP2     217-14409-5180chr7:
117431644-117431644
GAexonicUnknownstopgainNM_033427c.C1606Tp.R536X16.37-Stessman2017 T
CTTNBP2     M17505chr7:
117450932-117450932
TC/TexonicPaternal--Guo2018 T
CTTNBP2     320877chr7:
117420489-117420493
ACTCAAsplicingInheritedsplicing--Stessman2017 T
CTTNBP2     07C65257chr7:
117359623-117359623
CTexonicUnknownnonsynonymous SNVNM_033427c.G4579Ap.E1527K22.56.593E-5Stessman2017 T
CTTNBP2     ER47534chr7:
117417591-117417591
GAexonicDe novononsynonymous SNVNM_033427c.C2752Tp.H918Y26.9-O’Roak2014 T
CTTNBP2     1-0051-005chr7:
117596117-117596117
ACintergenicDe novo--Yuen2017 G
CTTNBP2     HEN0099.p1chr7:
117368147-117368147
CTexonicMaternalnonsynonymous SNVNM_033427c.G4051Ap.V1351M24.0-Guo2018 T
CTTNBP2     HEN0273.p1chr7:
117365112-117365112
TCexonicMaternalnonsynonymous SNVNM_033427c.A4255Gp.R1419G18.622.472E-5Guo2018 T
CTTNBP2     HN0190.p1chr7:
117432453-117432453
AGexonicMaternalnonsynonymous SNVNM_033427c.T797Cp.I266T12.162.0E-4Guo2018 T
CTTNBP2     HEN0079.p1chr7:
117432154-117432154
TAexonicMaternalnonsynonymous SNVNM_033427c.A1096Tp.I366F5.7411.647E-5Guo2018 T
CTTNBP2     HEN0211.p1chr7:
117397991-117397991
GAexonicMaternalnonsynonymous SNVNM_033427c.C3206Tp.A1069V5.3023.549E-5Guo2018 T
CTTNBP2     SX0019.p1chr7:
117397982-117397982
GAexonicMaternalnonsynonymous SNVNM_033427c.C3215Tp.P1072L16.311.779E-5Guo2018 T
CTTNBP2     M32724chr7:
117431853-117431853
GA/GexonicMaternal--Guo2018 T
CTTNBP2     HEN0137.p1chr7:
117431785-117431785
GCexonicMaternalnonsynonymous SNVNM_033427c.C1465Gp.R489G17.41-Guo2018 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More