or
or
Exact

Results for "GRIN2B"

Variant Events: 109

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GRIN2B     AU3847302chr12:
14348422-14348422
GCintergenicDe novo--Yuen2017 G
GRIN2B     1-0486-003chr12:
13779362-13779362
GAintronicDe novo--Yuen2017 G
GRIN2B     BK787-01chr12:
13724822-13724822
CTexonicDe novononsynonymous SNVNM_000834c.G2087Ap.R696H35.0-Wang2020 T
Wang2020 T
GRIN2B     HEN0197.p1chr12:
13906263-13906263
TCexonicMaternalnonsynonymous SNVNM_000834c.A998Gp.N333S10.571.647E-5Guo2018 T
GRIN2B     2-0202-004chr12:
14476732-14476732
GGTTCATTTTintergenicDe novo--Yuen2017 G
GRIN2B     SD0032.p1chr12:
13716168-13716168
GAexonicMaternalnonsynonymous SNVNM_000834c.C4004Tp.P1335L15.08-Guo2018 T
GRIN2B     HEN0101.p1chr12:
13715830-13715830
TCexonicMaternalnonsynonymous SNVNM_000834c.A4342Gp.I1448V10.7-Guo2018 T
GRIN2B     AU058104chr12:
13918351-13918351
CTintronicDe novo--Yuen2017 G
GRIN2B     1-0395-004chr12:
14427878-14427878
TCintergenicDe novo--Yuen2017 G
GRIN2B     G01-GEA-67-HIchr12:
13724822-13724822
CTexonicDe novononsynonymous SNVNM_000834c.G2087Ap.R696H35.0-Lim2017 E
Satterstrom2020 E
GRIN2B     1-0412-003chr12:
14184455-14184455
ATintergenicDe novo--Yuen2017 G
GRIN2B     Husson2020:136chr12:
14019119-14019119
AAGexonicframeshift insertionNM_000834c.23_24insCp.C8fs--Husson2020 E
GRIN2B     M12312chr12:
13717054-13717054
CTexonicMaternalnonsynonymous SNVNM_000834c.G3118Ap.G1040S16.141.649E-5Guo2018 T
Wang2016 T
GRIN2B     BK_662_01chr12:
13761545-13761545
CAexonicUnknownnonsynonymous SNVNM_000834c.G2002Tp.D668Y25.3-Wang2020 T
GRIN2B     AU030703chr12:
14018857-14018857
CAexonicUnknownnonsynonymous SNVNM_000834c.G286Tp.G96W24.5-Stessman2017 T
Wang2020 T
Wang2020 T
Wang2020 T
GRIN2B     AU4306302chr12:
14482997-14482997
GAintergenicDe novo--Yuen2017 G
GRIN2B     M12487chr12:
13716489-13716489
GAexonicPaternalnonsynonymous SNVNM_000834c.C3683Tp.T1228M0.2513.298E-5Guo2018 T
Wang2016 T
GRIN2B     M17613chr12:
13716489-13716489
GAexonicPaternalnonsynonymous SNVNM_000834c.C3683Tp.T1228M0.2513.298E-5Guo2018 T
Wang2016 T
GRIN2B     AU3853302chr12:
13735124-13735124
GAintronicDe novo--Yuen2017 G
GRIN2B     G01-GEA-123-HIchr12:
13717565-13717565
GCexonicDe novostopgainNM_000834c.C2607Gp.Y869X41.0-Lim2017 E
Satterstrom2020 E
GRIN2B     7-0167-003chr12:
13725273-13725273
TCintronicDe novo--Yuen2017 G
GRIN2B     73101263chr12:
13720146-13720146
TTCATTGTGACAAATGCCAexonicUnknownframeshift insertionNM_000834c.2410_2411insTGGCATTTGTCACAATGp.E804fs--Wang2020 T
Wang2020 T
GRIN2B     BK_642.01chr12:
13716735-13716735
CTexonicUnknownstopgainNM_000834c.G3437Ap.W1146X41.0-Wang2020 T
Wang2020 T
GRIN2B     BK_662.01chr12:
13761545-13761545
CAexonicUnknownnonsynonymous SNVNM_000834c.G2002Tp.D668Y25.3-Wang2020 T
GRIN2B     M16260chr12:
13715854-13715854
CAexonicMaternalnonsynonymous SNVNM_000834c.G4318Tp.A1440S0.8958.239E-6Guo2018 T
Wang2016 T
GRIN2B     1-0162-004chr12:
14201879-14201879
AGintergenicDe novo--Yuen2017 G
GRIN2B     A27chr12:
14481761-14481761
TGintergenicDe novo--Wu2018 G
GRIN2B     M8862chr12:
13716157-13716157
TCexonicUnknownnonsynonymous SNVNM_000834c.A4015Gp.M1339V11.19-Wang2016 T
GRIN2B     1-0214-003chr12:
14133666-14133666
GAupstreamDe novo--Yuen2017 G
GRIN2B     1-0534-006chr12:
14419294-14419294
ACintergenicDe novo--Yuen2017 G
GRIN2B     05C44735chr12:
13768147-13768147
GAexonicDe novostopgainNM_000834c.C1555Tp.R519X40.08.24E-6Satterstrom2020 E
GRIN2B     HEN0293.p1chr12:
13761764-13761764
GCexonicPaternalnonsynonymous SNVNM_000834c.C1783Gp.P595A15.918.298E-6Guo2018 T
GRIN2B     JS0047.p1chr12:
13716157-13716157
TCexonicPaternalnonsynonymous SNVNM_000834c.A4015Gp.M1339V11.19-Guo2018 T
GRIN2B     Yamamoto2019:11chr12:
13720107-13720107
TCexonicDe novononsynonymous SNVNM_000834c.A2450Gp.N817S26.4-Yamamoto2019 T
GRIN2B     HEN0329.p1chr12:
13906263-13906263
TCexonicPaternalnonsynonymous SNVNM_000834c.A998Gp.N333S10.571.647E-5Guo2018 T
GRIN2B     5-0073-003chr12:
14188837-14188837
CTintergenicDe novo--Yuen2017 G
GRIN2B     2-1620-003chr12:
14497912-14497918
CTATGATCintergenicDe novo--Yuen2017 G
GRIN2B     M12425chr12:
13716667-13716667
CTexonicMaternal, Unknownnonsynonymous SNVNM_000834c.G3505Ap.G1169R11.843.301E-5Guo2018 T
Wang2016 T
GRIN2B     1-0494-003chr12:
14419105-14419105
TCintergenicDe novo--Yuen2017 G
GRIN2B     HN0099.p1chr12:
13906497-13906497
GAexonicPaternalnonsynonymous SNVNM_000834c.C764Tp.T255M19.168.242E-6Guo2018 T
GRIN2B     1-0986-003chr12:
14143443-14143443
TCintergenicDe novo--Yuen2017 G
GRIN2B     GX0024.p1chr12:
13717061-13717061
GTexonicPaternalnonsynonymous SNVNM_000834c.C3111Ap.D1037E10.961.648E-5Guo2018 T
GRIN2B     GX0485.p1chr12:
13828782-13828782
TCexonicPaternalnonsynonymous SNVNM_000834c.A1022Gp.N341S23.5-Guo2018 T
GRIN2B     GX0394.p1chr12:
13717061-13717061
GTexonicPaternalnonsynonymous SNVNM_000834c.C3111Ap.D1037E10.961.648E-5Guo2018 T
GRIN2B     12681.p1chr12:
13722953-13722953
TCsplicingDe novosplicing17.06-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Willsey2013 E
GRIN2B     12547.p1chr12:
13764762-13764762
CTexonicDe novostopgainNM_000834c.G1677Ap.W559X41.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Willsey2013 E
GRIN2B     13932.p1chr12:
13768560-13768560
CTexonicDe novononsynonymous SNVNM_000834c.G1367Ap.C456Y27.6-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
GRIN2B     11540.p1chr12:
13848538-13848538
CTintronicMosaic--Dou2017 E
GRIN2B     11691.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_000834
NM_000834
c.99dupC
c.98dupC
p.S34fs
p.P33fs
-2.0E-4Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Wilfert2021 G
Willsey2013 E
GRIN2B     2-0013-003chr12:
14419309-14419309
GAintergenicDe novo--Yuen2017 G
GRIN2B     M20615chr12:
13769519-13769519
CTexonicPaternalnonsynonymous SNVNM_000834c.G1198Ap.E400K13.8-Guo2018 T
Wang2016 T
GRIN2B     M20277chr12:
13768147-13768147
GAexonicDe novostopgainNM_000834c.C1555Tp.R519X40.08.24E-6Guo2018 T
Stessman2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
GRIN2B     AU3951301chr12:
14323534-14323536
AAGAAAGAGintergenicDe novo--Yuen2017 G
GRIN2B     SF0048255.p1chr12:
13716277-13716277
GAexonicDe novononsynonymous SNVNM_000834c.C3895Tp.R1299C15.04-Wang2020 T
GRIN2B     B9M7Fchr12:
13828767-13828767
CTexonicUnknownnonsynonymous SNVNM_000834c.G1037Ap.G346E29.1-Stessman2017 T
Wang2020 T
Wang2020 T
GRIN2B     SP0017047chr12:
13717441-13717441
GAexonicDe novosynonymous SNVNM_000834c.C2731Tp.L911L--Feliciano2019 E
GRIN2B     08C77366chr12:
13768467-13768467
CGexonicDe novononsynonymous SNVNM_000834c.G1460Cp.G487A32.0-Stessman2017 T
GRIN2B     5-0025-004chr12:
14472241-14472241
TCintergenicDe novo--Yuen2017 G
GRIN2B     SF0059887.p1chr12:
13768490-13768490
GTexonicDe novostopgainNM_000834c.C1437Ap.Y479X40.0-Wang2020 T
GRIN2B     2-0307-003chr12:
14047382-14047382
TCintronicDe novo--Yuen2017 G
GRIN2B     SF0070933.p1chr12:
13724853-13724853
CTexonicDe novononsynonymous SNVNM_000834c.G2056Ap.V686M33.0-Wang2020 T
GRIN2B     Mahjani2021:35chr12:
13719963-13719963
CCTGATexonicframeshift insertionNM_000834c.2593_2594insATCAp.S865fs--Mahjani2021 E
GRIN2B     SF0109366.p2chr12:
13717381-13717381
CTexonicDe novononsynonymous SNVNM_000834c.G2791Ap.V931I0.198-Wang2020 T
GRIN2B     2-1508-003chr12:
14148783-14148783
AGintergenicDe novo--Yuen2017 G
GRIN2B     SF0010540.p1chr12:
13761545-13761545
CTexonicDe novononsynonymous SNVNM_000834c.G2002Ap.D668N34.0-Wang2020 T
GRIN2B     SF0142921.p1chr12:
13761536-13761536
CGsplicingDe novosplicing26.5-Wang2020 T
GRIN2B     Mahjani2021:36chr12:
13720137-13720137
TTCATTCTTCTCAexonicframeshift insertionNM_000834c.2419_2420insTGAGAAGAATGp.E807fs--Mahjani2021 E
GRIN2B     Mahjani2021:46chr12:
13724865-13724865
GAexonicnonsynonymous SNVNM_000834c.C2044Tp.R682C34.0-Mahjani2021 E
GRIN2B     M21987chr12:
13717337-13717337
GCexonicPaternal, Unknownnonsynonymous SNVNM_000834c.C2835Gp.D945E16.28-Guo2018 T
Wang2016 T
GRIN2B     Mahjani2021:41chr12:
13724822-13724822
CTexonicnonsynonymous SNVNM_000834c.G2087Ap.R696H35.0-Mahjani2021 E
GRIN2B     1-0651-003chr12:
14439380-14439380
CTintergenicDe novo--Yuen2017 G
GRIN2B     Mahjani2021:48chr12:
13769581-13769581
CTexonicstopgainNM_000834c.G1136Ap.W379X40.0-Mahjani2021 E
GRIN2B     Mahjani2021:47chr12:
13768083-13768083
CTexonicnonsynonymous SNVNM_000834c.G1619Ap.R540H29.6-Mahjani2021 E
GRIN2B     M12406chr12:
14019049-14019049
GTexonicMaternalnonsynonymous SNVNM_000834c.C94Ap.P32T12.42-Guo2018 T
Wang2016 T
GRIN2B     GX0019.p1chr12:
14019115-14019115
GAexonicMaternalnonsynonymous SNVNM_000834c.C28Tp.P10S14.61-Guo2018 T
GRIN2B     73101263chr12:
13720163-13720163
AACATTGTGACAAATGCCAexonicUnknownframeshift insertionNM_000834c.2393_2394insTGGCATTTGTCACAATGp.T798fs--Wang2020 T
Wang2020 T
GRIN2B     66295205chr12:
13717308-13717310
TCATexonicUnknownframeshift deletionNM_000834c.2862_2863delp.C954fs--Wang2020 T
Wang2020 T
GRIN2B     74764077chr12:
13768132-13768132
CTexonicUnknownnonsynonymous SNVNM_000834c.G1570Ap.D524N36.0-Wang2020 T
Wang2020 T
GRIN2B     12175.p1chr12:
14330773-14330773
GTintergenicDe novo--Turner2016 G
GRIN2B     13298.p1chr12:
14036159-14036159
GAintronicDe novo--Turner2016 G
GRIN2B     12175.p1chr12:
14330770-14330770
TGintergenicDe novo--Turner2016 G
GRIN2B     1-0395-003chr12:
14427878-14427878
TCintergenicDe novo--Yuen2017 G
GRIN2B     559.03chr12:
13722953-13722953
TCsplicingDe novosplicing17.06-Wang2020 T
Wang2020 T
GRIN2B     1-0539-003chr12:
13966812-13966812
TCintronicDe novo--Yuen2017 G
GRIN2B     2-1444-003chr12:
13815101-13815101
AGintronicDe novo--Yuen2016 G
Yuen2017 G
GRIN2B     04C24300chr12:
14018857-14018857
CAexonicUnknownnonsynonymous SNVNM_000834c.G286Tp.G96W24.5-Stessman2017 T
Wang2020 T
Wang2020 T
GRIN2B     150281chr12:
13906250-13906250
CTsplicingInherited, Unknownsplicing22.9-Stessman2017 T
Wang2020 T
Wang2020 T
Wang2020 T
GRIN2B     AU047703chr12:
13950399-13950399
GAintronicDe novo--Yuen2017 G
GRIN2B     AU3692302chr12:
14316268-14316268
CAintergenicDe novo--Yuen2017 G
GRIN2B     Kenny2014:6chr12:
13724778-13724778
GAexonicUnknownstopgainNM_000834c.C2131Tp.Q711X42.0-Kenny2014 T
GRIN2B     M16114chr12:
13715902-13715902
GAexonicMaternalnonsynonymous SNVNM_000834c.C4270Tp.L1424F8.6862.476E-5Guo2018 T
Wang2016 T
GRIN2B     185718chr12:
13764658-13764658
CTsplicingInherited, Unknownsplicing34.0-Stessman2017 T
Wang2020 T
Wang2020 T
Wang2020 T
GRIN2B     M15056chr12:
13715916-13715916
GAexonicMaternalnonsynonymous SNVNM_000834c.C4256Tp.P1419L14.848.26E-6Guo2018 T
Wang2016 T
GRIN2B     M3803chr12:
13716156-13716156
AGexonicMaternalnonsynonymous SNVNM_000834c.T4016Cp.M1339T12.0-Wang2016 T
GRIN2B     2-1485-003chr12:
14419082-14419082
AGintergenicDe novo--Yuen2017 G
GRIN2B     ASD046chr12:
13722914-13722914
TTCexonicDe novoframeshift insertionNM_000834c.2208dupGp.N737fs--Tran2020 E
Wu2019 E
GRIN2B     GD0231.p1chr12:
13768083-13768083
CTexonicUnknownnonsynonymous SNVNM_000834c.G1619Ap.R540H29.6-Wang2020 T
Wang2020 T
GRIN2B     A21chr12:
14393717-14393717
CTintergenicDe novo--Wu2018 G
GRIN2B     549.03chr12:
13768560-13768560
CTexonicUnknownnonsynonymous SNVNM_000834c.G1367Ap.C456Y27.6-Wang2020 T
Wang2020 T
GRIN2B     2-1416-004chr12:
14476977-14476977
CAintergenicDe novo--Yuen2017 G
GRIN2B     AU3881301chr12:
14196220-14196220
CTintergenicDe novo--Yuen2017 G
GRIN2B     BK789-01chr12:
13724849-13724849
GAexonicDe novononsynonymous SNVNM_000834c.C2060Tp.P687L34.0-Wang2020 T
Wang2020 T
GRIN2B     216-4499-1chr12:
13768129-13768129
ACexonicDe novononsynonymous SNVNM_000834c.T1573Gp.F525V32.0-O’Roak2014 T
GRIN2B     M08862chr12:
13716157-13716157
TCexonicPaternalnonsynonymous SNVNM_000834c.A4015Gp.M1339V11.19-Guo2018 T
GRIN2B     25chr12:
13764781-13764781
GAexonicDe novononsynonymous SNVNM_000834c.C1658Tp.P553L19.92-O’Roak2014 T
GRIN2B     SX0065.p1chr12:
13724822-13724822
CTexonicUnknownnonsynonymous SNVNM_000834c.G2087Ap.R696H35.0-Wang2020 T
Wang2020 T
GRIN2B     AU3881301chr12:
14299537-14299537
GAintergenicDe novo--Yuen2017 G
GRIN2B     2-1297-004chr12:
14310804-14310804
GTintergenicDe novo--Yuen2017 G
GRIN2B     Stessman2017:ASD_1032-1chr12:
13716708-13716715
TAGATGTCTAGATGTTAGATGTCexonicInheritedstopgainNM_000834c.3464_3465insACATCTAp.Y1155_K1156delinsX--Stessman2017 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More