or
or
Exact

Results for "GIGYF2"

Variant Events: 63

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GIGYF2     AC05-0021-04chr2:
233684582-233684582
CTexonicDe novostopgainNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C2398T
c.C2416T
c.C2479T
c.C2416T
p.R800X
p.R806X
p.R827X
p.R806X
40.0-Lim2017 E
Satterstrom2020 E
GIGYF2     210-18178-301chr2:
233612432-233612432
CTexonicMaternal, Unknownnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C149T
c.C149T
c.C149T
c.C149T
p.A50V
p.A50V
p.A50V
p.A50V
35.0-Wang2020 T
Wang2020 T
Wang2020 T
GIGYF2     M08308chr2:
233675964-233675964
GAexonicDe novononsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G1891A
c.G1909A
c.G1972A
c.G1909A
p.A631T
p.A637T
p.A658T
p.A637T
13.45-Guo2018 T
GIGYF2     M23762chr2:
233655745-233655745
GTexonicDe novostopgainNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G940T
c.G958T
c.G1024T
c.G958T
p.E314X
p.E320X
p.E342X
p.E320X
34.0-Guo2018 T
Stessman2017 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
GIGYF2     HN0190.p1chr2:
233709178-233709178
AGexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A3181G
c.A3199G
c.A3262G
c.A3199G
p.S1061G
p.S1067G
p.S1088G
p.S1067G
5.6678.243E-6Guo2018 T
GIGYF2     HEN0158.p1chr2:
233675961-233675961
TCexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.T1888C
c.T1906C
c.T1969C
c.T1906C
p.Y630H
p.Y636H
p.Y657H
p.Y636H
14.248.254E-6Guo2018 T
GIGYF2     2-0110-003chr2:
233648087-233648098
GTTTATTTATTTGTTTATTTintronicDe novo--Yuen2017 G
GIGYF2     M15217chr2:
233655527-233655527
AGexonicPaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A814G
c.A832G
c.A898G
c.A832G
p.I272V
p.I278V
p.I300V
p.I278V
9.8712.0E-4Wang2016 T
GIGYF2     M19744chr2:
233656136-233656136
AGexonicPaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A1244G
c.A1262G
c.A1325G
c.A1262G
p.K415R
p.K421R
p.K442R
p.K421R
11.427.83E-5Wang2016 T
GIGYF2     14533.p1chr2:
233675982-233675982
CTexonicDe novostopgainNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C1909T
c.C1927T
c.C1990T
c.C1927T
p.Q637X
p.Q643X
p.Q664X
p.Q643X
37.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
GIGYF2     M15185chr2:
233677147-233677147
GAexonicPaternal, Unknownnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G2035A
c.G2053A
c.G2116A
c.G2053A
p.V679M
p.V685M
p.V706M
p.V685M
17.911.652E-5Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
Wang2020 T
GIGYF2     M27812chr2:
233659563-233659563
GAexonicPaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G1370A
c.G1388A
c.G1451A
c.G1388A
p.R457Q
p.R463Q
p.R484Q
p.R463Q
14.831.0E-4Guo2018 T
Wang2016 T
GIGYF2     M20406chr2:
233704609-233704609
GCexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G2799C
c.G2817C
c.G2880C
c.G2817C
p.Q933H
p.Q939H
p.Q960H
p.Q939H
13.91-Guo2018 T
Wang2016 T
GIGYF2     M19802chr2:
233612356-233612356
AGexonicPaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A73G
c.A73G
c.A73G
c.A73G
p.T25A
p.T25A
p.T25A
p.T25A
14.15.0E-4Wang2016 T
GIGYF2     M20250chr2:
233612356-233612356
AGexonicPaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A73G
c.A73G
c.A73G
c.A73G
p.T25A
p.T25A
p.T25A
p.T25A
14.15.0E-4Wang2016 T
GIGYF2     09C86398chr2:
233681583-233681583
AGexonicDe novosynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A2193G
c.A2211G
c.A2274G
c.A2211G
p.L731L
p.L737L
p.L758L
p.L737L
-1.652E-5Satterstrom2020 E
GIGYF2     M12526chr2:
233704659-233704659
GAexonicUnknownnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G2849A
c.G2867A
c.G2930A
c.G2867A
p.R950Q
p.R956Q
p.R977Q
p.R956Q
36.04.135E-5Guo2018 T
Wang2016 T
GIGYF2     AU4029302chr2:
233682583-233682583
ATintronicDe novo--Yuen2017 G
GIGYF2     M31959chr2:
233659479-233659479
AGexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A1286G
c.A1304G
c.A1367G
c.A1304G
p.Q429R
p.Q435R
p.Q456R
p.Q435R
12.71-Guo2018 T
GIGYF2     1-0556-003chr2:
233676246-233676246
GAintronicDe novo--Yuen2017 G
GIGYF2     GX0527.p1chr2:
233704620-233704620
CTexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C2810T
c.C2828T
c.C2891T
c.C2828T
p.T937M
p.T943M
p.T964M
p.T943M
18.74-Guo2018 T
GIGYF2     M32295chr2:
233659563-233659563
GAexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G1370A
c.G1388A
c.G1451A
c.G1388A
p.R457Q
p.R463Q
p.R484Q
p.R463Q
14.831.0E-4Guo2018 T
GIGYF2     1-0720-003chr2:
233644702-233644702
AGintronicDe novo--Yuen2017 G
GIGYF2     M15067chr2:
233709077-233709089
AGCATTCCAACCTAexonicUnknownframeshift deletionNM_001103148
NM_001103146
NM_001103147
NM_015575
c.3082_3092del
c.3100_3110del
c.3163_3173del
c.3100_3110del
p.H1028fs
p.H1034fs
p.H1055fs
p.H1034fs
--Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
GIGYF2     2-1408-004chr2:
233620306-233620306
CTintronicDe novo--Yuen2017 G
GIGYF2     M21301chr2:
233671257-233671257
TG/TexonicMaternal--Guo2018 T
GIGYF2     M08641chr2:
233613755-233613755
CTexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C230T
c.C230T
c.C230T
c.C230T
p.P77L
p.P77L
p.P77L
p.P77L
3.17-Guo2018 T
GIGYF2     ASDFI_1650chr2:
233704659-233704659
GAexonicDe novononsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G2849A
c.G2867A
c.G2930A
c.G2867A
p.R950Q
p.R956Q
p.R977Q
p.R956Q
36.04.135E-5DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Wang2020 T
GIGYF2     2-1501-003chr2:
233682815-233682815
ATintronicDe novo--Yuen2017 G
GIGYF2     60066750chr2:
233655600-233655600
CTexonicUnknownnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C887T
c.C905T
c.C971T
c.C905T
p.S296L
p.S302L
p.S324L
p.S302L
32.0-Wang2020 T
Wang2020 T
GIGYF2     08C77632chr2:
233677165-233677165
AGexonicDe novononsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A2053G
c.A2071G
c.A2134G
c.A2071G
p.I685V
p.I691V
p.I712V
p.I691V
12.32-Satterstrom2020 E
GIGYF2     Lim2017:36806chr2:
233675982-233675982
CTexonicDe novostopgainNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C1909T
c.C1927T
c.C1990T
c.C1927T
p.Q637X
p.Q643X
p.Q664X
p.Q643X
37.0-Lim2017 E
GIGYF2     M17539 Complex Event; expand row to view variants  Maternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G2035A
c.G2053A
c.G2116A
c.G2053A
p.V679M
p.V685M
p.V706M
p.V685M
17.911.652E-5Guo2018 T
Wang2020 T
Wang2020 T
GIGYF2     M08563chr2:
233676047-233676047
GC/GexonicMaternal--Guo2018 T
GIGYF2     M17637chr2:
233655615-233655615
TGexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.T902G
c.T920G
c.T986G
c.T920G
p.L301R
p.L307R
p.L329R
p.L307R
18.28.241E-5Wang2016 T
GIGYF2     M21566chr2:
233671257-233671257
TGexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.T1678G
c.T1696G
c.T1759G
c.T1696G
p.S560A
p.S566A
p.S587A
p.S566A
17.88.237E-6Guo2018 T
Wang2016 T
GIGYF2     3-0392-000chr2:
233731449-233731449
ACintergenicDe novo--Yuen2016 G
GIGYF2     M8308chr2:
233675964-233675964
GAexonicDe novononsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G1891A
c.G1909A
c.G1972A
c.G1909A
p.A631T
p.A637T
p.A658T
p.A637T
13.45-Wang2016 T
GIGYF2     M8641chr2:
233613755-233613755
CTexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C230T
c.C230T
c.C230T
c.C230T
p.P77L
p.P77L
p.P77L
p.P77L
3.17-Wang2016 T
GIGYF2     M23679chr2:
233671353-233671353
CTexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C1774T
c.C1792T
c.C1855T
c.C1792T
p.P592S
p.P598S
p.P619S
p.P598S
22.7-Guo2018 T
Wang2016 T
GIGYF2     108602-100chr2:
233655450-233655450
GAexonicUnknownnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G737A
c.G755A
c.G821A
c.G755A
p.R246H
p.R252H
p.R274H
p.R252H
34.0-Wang2020 T
Wang2020 T
GIGYF2     AU3703302chr2:
233604531-233604531
CTintronicDe novo--Yuen2017 G
GIGYF2     M15196chr2:
233712060-233712060
CAexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C3445A
c.C3463A
c.C3526A
c.C3463A
p.P1149T
p.P1155T
p.P1176T
p.P1155T
23.93.0E-4Wang2016 T
GIGYF2     HN0144.p1chr2:
233671353-233671353
CTexonicPaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C1774T
c.C1792T
c.C1855T
c.C1792T
p.P592S
p.P598S
p.P619S
p.P598S
22.7-Guo2018 T
GIGYF2     GX0552.p1chr2:
233671311-233671311
AGexonicPaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A1732G
c.A1750G
c.A1813G
c.A1750G
p.M578V
p.M584V
p.M605V
p.M584V
18.9-Guo2018 T
GIGYF2     HEN0100.p1chr2:
233681692-233681692
GAexonicPaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G2302A
c.G2320A
c.G2383A
c.G2320A
p.E768K
p.E774K
p.E795K
p.E774K
16.15-Guo2018 T
GIGYF2     HEN0297.p1chr2:
233677147-233677147
GA/GexonicPaternal--Guo2018 T
GIGYF2     13611.p1chr2:
233712061-233712061
CGexonicDe novononsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C3446G
c.C3464G
c.C3527G
c.C3464G
p.P1149R
p.P1155R
p.P1176R
p.P1155R
23.4-Ji2016 E
Krumm2015 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
GIGYF2     GX0287.p1chr2:
233655725-233655725
AGexonicPaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A920G
c.A938G
c.A1004G
c.A938G
p.Q307R
p.Q313R
p.Q335R
p.Q313R
17.1-Guo2018 T
GIGYF2     M15008chr2:
233659562-233659562
CTexonicUnknownnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C1369T
c.C1387T
c.C1450T
c.C1387T
p.R457W
p.R463W
p.R484W
p.R463W
19.371.648E-5Wang2020 T
Wang2020 T
GIGYF2     320515chr2:
233655446-233655446
CTexonicInherited, UnknownstopgainNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C733T
c.C751T
c.C817T
c.C751T
p.R245X
p.R251X
p.R273X
p.R251X
37.0-Stessman2017 T
Wang2020 T
Wang2020 T
Wang2020 T
GIGYF2     M31863chr2:
233709178-233709178
AGexonicPaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A3181G
c.A3199G
c.A3262G
c.A3199G
p.S1061G
p.S1067G
p.S1088G
p.S1067G
5.6678.243E-6Guo2018 T
GIGYF2     GX0022.p1chr2:
233681597-233681597
GAexonicPaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G2207A
c.G2225A
c.G2288A
c.G2225A
p.R736K
p.R742K
p.R763K
p.R742K
11.788.255E-6Guo2018 T
GIGYF2     GZ0003.p1chr2:
233626107-233626107
GTexonicUnknownnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G493T
c.G493T
c.G493T
c.G493T
p.G165C
p.G165C
p.G165C
p.G165C
21.08.283E-6Wang2020 T
Wang2020 T
GIGYF2     AU3984301chr2:
233733475-233733481
CCAAACACCAintergenicDe novo--Yuen2017 G
GIGYF2     M30940chr2:
233715059-233715059
GCexonicPaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.G3754C
c.G3772C
c.G3835C
c.G3772C
p.V1252L
p.V1258L
p.V1279L
p.V1258L
17.53-Guo2018 T
GIGYF2     1-0971-003chr2:
233655935-233655935
CGintronicDe novo--Yuen2017 G
GIGYF2     TIGER_90044-201chr2:
233660821-233660821
AGexonicDe novononsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A1511G
c.A1529G
c.A1592G
c.A1529G
p.E504G
p.E510G
p.E531G
p.E510G
32.0-Wang2020 T
Wang2020 T
GIGYF2     M01903chr2:
233659563-233659563
GA/GexonicPaternal--Guo2018 T
GIGYF2     M26843chr2:
233656136-233656136
AGexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A1244G
c.A1262G
c.A1325G
c.A1262G
p.K415R
p.K421R
p.K442R
p.K421R
11.427.83E-5Wang2016 T
GIGYF2     M1763chr2:
233612356-233612356
AGexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A73G
c.A73G
c.A73G
c.A73G
p.T25A
p.T25A
p.T25A
p.T25A
14.15.0E-4Wang2016 T
GIGYF2     M2213chr2:
233655527-233655527
AGexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.A814G
c.A832G
c.A898G
c.A832G
p.I272V
p.I278V
p.I300V
p.I278V
9.8712.0E-4Wang2016 T
GIGYF2     AU2487301chr2:
233612432-233612432
CTexonicMaternalnonsynonymous SNVNM_001103148
NM_001103146
NM_001103147
NM_015575
c.C149T
c.C149T
c.C149T
c.C149T
p.A50V
p.A50V
p.A50V
p.A50V
35.0-Wang2020 T
Wang2020 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More