
Results for "ADNP"

Variant Events: 107

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
ADNP     BK755-01chr20:
GTexonicDe novostopgainNM_001282532
38.0-Wang2020 T
Wang2020 T
ADNP     GX0124.p1chr20:
TGexonicPaternalnonsynonymous SNVNM_001282532
12.49-Guo2018 T
ADNP     111294chr20:
CTTTACexonicDe novoframeshift deletionNM_001282532
--Helsmoortel2014 T
ADNP     M32301chr20:
GAexonicPaternalnonsynonymous SNVNM_001282532
11.81-Guo2018 T
ADNP     035-09-110762chr20:
ACexonicDe novostopgainNM_001282532
45.0-Satterstrom2020 E
ADNP     11-08612chr20:
GTexonicDe novostopgainNM_001282532
40.0-Helsmoortel2014 T
ADNP     GX0471.p1chr20:
CTexonicPaternalnonsynonymous SNVNM_001282532
15.971.648E-5Guo2018 T
ADNP     SD0091.p1chr20:
39.0-Wang2020 T
Wang2020 T
ADNP     1050237chr20:
CATTTGCTCGTAAGCexonicDe novoframeshift deletionNM_001282532
--Helsmoortel2014 T
ADNP     M30841chr20:
GAexonicPaternalnonsynonymous SNVNM_001282532
4.5771.649E-5Guo2018 T
ADNP     3061-08Dchr20:
GCexonicDe novostopgainNM_001282532
38.0-Helsmoortel2014 T
ADNP     M12352chr20:
AGexonicUnknownnonsynonymous SNVNM_001282532
5.8718.24E-6Wang2016 T
ADNP     122793chr20:
TTTAATexonicDe novoframeshift deletionNM_001282532
--Helsmoortel2014 T
ADNP     07-06960chr20:
CGCexonicDe novostopgainNM_001282532
--Helsmoortel2014 T
ADNP     HN0125.p1chr20:
CTexonicPaternalnonsynonymous SNVNM_001282532
0.019-Guo2018 T
ADNP     2376chr20:
TTTAATexonicDe novoframeshift deletionNM_001282532
--Helsmoortel2014 T
ADNP     2533chr20:
42.0-Helsmoortel2014 T
ADNP     13545.p1 Complex Event; expand row to view variants  De novostopgainNM_001282532
--Helsmoortel2014 T
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
ADNP     GX0202.p1chr20:
TCexonicPaternalnonsynonymous SNVNM_001282532
6.793-Guo2018 T
ADNP     M8878chr20:
CTexonicDe novononsynonymous SNVNM_001282532
17.678.238E-5Wang2016 T
ADNP     GX0435.p1chr20:
CTexonicPaternalnonsynonymous SNVNM_001282532
4.0132.471E-5Guo2018 T
ADNP     AU4242302chr20:
CTdownstreamDe novo--Yuen2017 G
ADNP     SD0063.p1chr20:
TCexonicPaternalnonsynonymous SNVNM_001282532
11.65-Guo2018 T
ADNP     M15242chr20:
CTexonicMaternalnonsynonymous SNVNM_001282532
0.019-Guo2018 T
Wang2016 T
ADNP     M01853 Complex Event; expand row to view variants  Maternal, Unknownnonsynonymous SNV, frameshift insertionNM_001282532
11.658.261E-6Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
ADNP     M27882chr20:
ATexonicDe novostopgainNM_001282532
39.0-Guo2018 T
Stessman2017 T
Wang2016 T
Wang2020 T
Wang2020 T
ADNP     SF0086863.p1chr20:
GCexonicDe novostopgainNM_001282532
38.0-Wang2020 T
ADNP     SF0000938.p1chr20:
GAGexonicDe novoframeshift deletionNM_001282532
--Wang2020 T
ADNP     HEN0265.p1chr20:
CAexonicPaternalnonsynonymous SNVNM_001282532
8.1873.295E-5Guo2018 T
ADNP     GX0558.p1chr20:
ACexonicPaternalnonsynonymous SNVNM_001282532
12.21-Guo2018 T
ADNP     HEN0250.p1chr20:
GAexonicPaternalnonsynonymous SNVNM_001282532
12.738.454E-6Guo2018 T
ADNP     BK_673.01chr20:
GAGexonicUnknownframeshift deletionNM_001282532
--Wang2020 T
ADNP     SF0036574.p1chr20:
CCACexonicDe novoframeshift deletionNM_001282532
--Wang2020 T
ADNP     SF0036637.p1chr20:
ACexonicDe novononsynonymous SNVNM_001282532
17.32-Wang2020 T
ADNP     SF0075687.p1chr20:
CCTAACexonicDe novoframeshift deletionNM_001282532
--Wang2020 T
ADNP     SF0131947.p1chr20:
CCTTGGCexonicDe novoframeshift deletionNM_001282532
--Wang2020 T
ADNP     SF0081420.p1chr20:
GTexonicDe novostopgainNM_001282532
38.0-Wang2020 T
ADNP     SF0041760.p1chr20:
GTexonicDe novostopgainNM_001282532
38.0-Wang2020 T
ADNP     SF0036637.p1chr20:
ACexonicDe novononsynonymous SNVNM_001282532
16.78-Wang2020 T
ADNP     SF0042813.p1chr20:
TGexonicDe novononsynonymous SNVNM_001282532
17.1-Wang2020 T
ADNP     M16139chr20:
GAexonicPaternalnonsynonymous SNVNM_001282532
8.4788.238E-6Guo2018 T
Wang2016 T
ADNP     M15147chr20:
GAexonicPaternalnonsynonymous SNVNM_001282532
7.644-Guo2018 T
Wang2016 T
ADNP     ASD-821chr20:
AGexonicDe novononsynonymous SNVNM_001282532
24.3-Du2018 E
ADNP     SF0104108.p1chr20:
CAACexonicDe novoframeshift deletionNM_001282532
--Wang2020 T
ADNP     D’Gama2015:797chr20:
CAexonicUnknownnonsynonymous SNVNM_001282532
16.38.633E-6D’Gama2015 T
ADNP     SF0130990.p1chr20:
CCTAACexonicDe novoframeshift deletionNM_001282532
--Wang2020 T
ADNP     SF0103630.p3chr20:
AGexonicDe novononsynonymous SNVNM_001282532
14.19-Wang2020 T
ADNP     SF0082696.p1chr20:
CCTexonicDe novostopgainNM_001282532
--Wang2020 T
ADNP     M30823chr20:
ACexonicMaternalnonsynonymous SNVNM_001282532
12.21-Guo2018 T
ADNP     GX0033.p1chr20:
TCexonicMaternalnonsynonymous SNVNM_001282532
0.578-Guo2018 T
ADNP     GX0091.p1chr20:
AGexonicMaternalnonsynonymous SNVNM_001282532
13.95-Guo2018 T
ADNP     GX0403.p1chr20:
GAexonicMaternalnonsynonymous SNVNM_001282532
11.59-Guo2018 T
ADNP     GX0309.p1chr20:
GAexonicMaternalnonsynonymous SNVNM_001282532
17.38-Guo2018 T
ADNP     SD0087.p1chr20:
TATexonicUnknownframeshift deletionNM_001282532
--Guo2018 T
Wang2020 T
Wang2020 T
ADNP     AU024104chr20:
GAintronicDe novo--Yuen2017 G
ADNP     M27874chr20:
TAexonicMaternalnonsynonymous SNVNM_001282532
14.171.648E-5Guo2018 T
Wang2016 T
ADNP     M8121chr20:
CTexonicUnknownnonsynonymous SNVNM_001282532
0.019-Wang2016 T
ADNP     SP0001740chr20:
GACCCTTGGGGTCTAAAGCTAAAACAGexonicDe novoframeshift deletionNM_001282532
--Feliciano2019 E
ADNP     AU019604chr20:
CCTexonicMaternal, Unknownframeshift insertionNM_001282532
-8.261E-6Wang2020 T
Wang2020 T
ADNP     08C76513chr20:
ATexonicDe novostopgainNM_001282532
45.0-Satterstrom2020 E
ADNP     12130.p1chr20:
CTTCexonicDe novoframeshift deletionNM_001282532
--Dong2014 E
Helsmoortel2014 T
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2012b E
O’Roak2014 T
Wang2020 T
Wilfert2021 G
Willsey2013 E
ADNP     1-0382-003chr20:
TCUTR3De novo--Yuen2017 G
ADNP     GX0639.p1chr20:
46.0-Wang2020 T
Wang2020 T
ADNP     HEN0007.p1chr20:
CCTexonicUnknownframeshift insertionNM_001282532
--Wang2020 T
Wang2020 T
ADNP     12707.p1chr20:
GGGGexonicMaternalframeshift insertionNM_001282532
--O’Roak2012a T
ADNP     M03533chr20:
GAexonicMaternalnonsynonymous SNVNM_001282532
31.0-Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
ADNP     M16274chr20:
TCexonicPaternalnonsynonymous SNVNM_001282532
11.081.648E-5Guo2018 T
Wang2016 T
ADNP     M15199chr20:
TCexonicPaternalnonsynonymous SNVNM_001282532
0.1948.237E-6Guo2018 T
Wang2016 T
ADNP     M08121chr20:
CTexonicPaternalnonsynonymous SNVNM_001282532
0.019-Guo2018 T
ADNP     M18390chr20:
CTexonicPaternalnonsynonymous SNVNM_001282532
15.847.414E-5Guo2018 T
Wang2016 T
ADNP     SX0083.p1chr20:
40.0-Wang2020 T
Wang2020 T
ADNP     HN0024.p1chr20:
41.0-Wang2020 T
Wang2020 T
ADNP     5941chr20:
38.0-Wang2020 T
Wang2020 T
ADNP     08C73958chr20:
CCAexonicDe novoframeshift insertionNM_001282532
--Satterstrom2020 E
ADNP     M03713chr20:
CA/CexonicPaternal--Guo2018 T
ADNP     M08083chr20:
TCexonicPaternalnonsynonymous SNVNM_001282532
16.12-Guo2018 T
ADNP     62538053chr20:
CCAexonicUnknownframeshift insertionNM_001282532
--Wang2020 T
Wang2020 T
ADNP     85803369chr20:
TTCTexonicUnknownframeshift deletionNM_001282532
--Wang2020 T
Wang2020 T
ADNP     COL1111.03chr20:
CTTCexonicDe novoframeshift deletionNM_001282532
--Satterstrom2020 E
ADNP     G01-GEA-207-HIchr20:
TCTTCTexonicDe novoframeshift deletionNM_001282532
--Satterstrom2020 E
ADNP     M13413chr20:
GCexonicMaternalnonsynonymous SNVNM_001282532
15.468.238E-5Wang2016 T
ADNP     1-0353-003chr20:
ATexonicDe novostopgainNM_001282532
45.0-Wang2020 T
Yuen2017 G
ADNP     M17485chr20:
TGexonicUnknownnonsynonymous SNVNM_001282532
0.1172.0E-4Wang2016 T
ADNP     IGM1648671chr20:
TCexonicDe novononsynonymous SNVNM_001282532
11.49-Satterstrom2020 E
ADNP     211-5367-3chr20:
ATexonicDe novostopgainNM_001282532
45.0-O’Roak2014 T
Stessman2017 T
Stessman2017 T
Wang2020 T
Wang2020 T
ADNP     1986-24087chr20:
ACAexonicframeshift deletionNM_001282532
--Callaghan2019 G
ADNP     566.03chr20:
AGAexonicUnknownframeshift deletionNM_001282532
--Wang2020 T
Wang2020 T
ADNP     569.03chr20:
CCACexonicUnknownframeshift deletionNM_001282532
--Wang2020 T
Wang2020 T
ADNP     2-0028-003 Complex Event; expand row to view variants  De novoframeshift deletionNM_001282532
--Wang2020 T
Yuen2016 G
Yuen2017 G
ADNP     Cherot2017:1chr20:
39.0-Cherot2017 E
ADNP     ASC_CA_75_Achr20:
GGAexonicDe novoframeshift insertionNM_001282532
--Satterstrom2020 E
ADNP     HEN0171.p1chr20:
CTexonicMaternalnonsynonymous SNVNM_001282532
15.847.414E-5Guo2018 T
ADNP     HEN0258.p1chr20:
ATexonicMaternalnonsynonymous SNVNM_001282532
11.02-Guo2018 T
ADNP     SX0011.p1chr20:
CTexonicMaternalnonsynonymous SNVNM_001282532
0.4857.419E-5Guo2018 T
ADNP     Mahjani2021:95chr20:
CTTCexonicframeshift deletionNM_001282532
--Mahjani2021 E
ADNP     GX0536.p1chr20:
CTexonicMaternalnonsynonymous SNVNM_001282532
9.9748.238E-6Guo2018 T
ADNP     DEASD_0149_001chr20:
CCTCACexonicDe novoframeshift deletionNM_001282532
--DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
ADNP     DEASD_0076_001chr20:
CTCGGGCATCexonicDe novoframeshift deletionNM_001282532
--DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
ADNP     BK_673_01chr20:
GAGexonicUnknownframeshift deletionNM_001282532
--Wang2020 T
ADNP     213-8763-103chr20:
CCAexonicDe novoframeshift insertionNM_001282532
--O’Roak2014 T
ADNP     BK_683_01chr20:
GAexonicDe novostopgainNM_001282532
41.0-Wang2020 T
Wang2020 T
ADNP     BK767-01chr20:
GGTexonicDe novoframeshift insertionNM_001282532
--Wang2020 T
Wang2020 T
ADNP     BK_720_01chr20:
TGTexonicDe novoframeshift deletionNM_001282532
--Wang2020 T
Wang2020 T
ADNP     56744chr20:
TAexonicUnknownnonsynonymous SNVNM_001282532
27.4-Stessman2017 T
Wang2020 T
Wang2020 T
ADNP     TIGER_T204-03chr20:
GTexonicUnknown, De novostopgainNM_001282532
38.0-Wang2020 T
Wang2020 T
Wang2020 T
ADNP     M8258chr20:
AGexonicUnknownnonsynonymous SNVNM_001282532
5.8718.24E-6Wang2016 T
ADNP     BK_714_01chr20:
CTTTACexonicDe novoframeshift deletionNM_001282532
--Wang2020 T
Wang2020 T
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView