or
or
Exact

Results for "MED13L"

Variant Events: 94

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MED13L     HN0061.p1chr12:
116457747-116457747
GAexonicPaternalnonsynonymous SNVNM_015335c.C656Tp.T219M16.892.0E-4Guo2018 T
MED13L     M10159chr12:
116429431-116429431
AGexonicUnknownnonsynonymous SNVNM_015335c.T3328Cp.Y1110H16.28-Wang2016 T
MED13L     GX0128.p1chr12:
116446851-116446851
GCexonicPaternalnonsynonymous SNVNM_015335c.C1367Gp.S456C14.39-Guo2018 T
MED13L     M31840chr12:
116446308-116446308
CTexonicPaternalnonsynonymous SNVNM_015335c.G1910Ap.R637H11.791.0E-4Guo2018 T
MED13L     M30330chr12:
116457645-116457645
GAexonicPaternalnonsynonymous SNVNM_015335c.C758Tp.S253L7.177.423E-5Guo2018 T
MED13L     635-18522chr12:
116399093-116399093
TCexonicInheritednonsynonymous SNVNM_015335c.A6611Gp.N2204S27.3-Callaghan2019 G
MED13L     GX0215.p1chr12:
116446851-116446851
GCexonicPaternalnonsynonymous SNVNM_015335c.C1367Gp.S456C14.39-Guo2018 T
MED13L     AU2117302chr12:
116444539-116444539
AGintronicDe novo--Yuen2017 G
MED13L     JS0072.p1chr12:
116409976-116409976
GAexonicMaternalnonsynonymous SNVNM_015335c.C5797Tp.R1933W22.7-Guo2018 T
MED13L     1006001chr12:
116446798-116446802
CCTGTCexonicDe novoframeshift deletionNM_015335c.1416_1419delp.R472fs--Satterstrom2020 E
MED13L     09C91528chr12:
116434859-116434859
CAexonicDe novostopgainNM_015335c.G2746Tp.E916X43.0-Stessman2017 T
Stessman2017 T
MED13L     1-0985-003chr12:
116574708-116574708
TCintronicDe novo--Yuen2017 G
MED13L     M12490chr12:
116403957-116403957
GAexonicMaternalnonsynonymous SNVNM_015335c.C6317Tp.A2106V36.0-Guo2018 T
Wang2016 T
MED13L     M21650chr12:
116446833-116446833
GAexonicUnknownnonsynonymous SNVNM_015335c.C1385Tp.P462L15.523.295E-5Wang2016 T
MED13L     M01693chr12:
116420372-116420372
CC/GexonicPaternal--Guo2018 T
MED13L     152190chr12:
116418554-116418554
CAsplicingDe novosplicing21.1-Satterstrom2020 E
MED13L     HN0070.p1chr12:
116429039-116429039
CCAexonicDe novoframeshift insertionNM_015335c.3719dupTp.L1240fs--Guo2018 T
MED13L     HEN0261.p1chr12:
116422077-116422077
AGexonicMaternalnonsynonymous SNVNM_015335c.T4439Cp.V1480A20.9-Guo2018 T
MED13L     7-0024-005chr12:
116655412-116655412
AAAACACGintronicDe novo--Yuen2017 G
MED13L     M08314chr12:
116418576-116418576
CGexonicPaternalnonsynonymous SNVNM_015335c.G5343Cp.E1781D12.35-Guo2018 T
MED13L     M21513chr12:
116413542-116413542
CTexonicPaternalnonsynonymous SNVNM_015335c.G5366Ap.R1789Q17.341.692E-5Wang2016 T
MED13L     M19571chr12:
116418581-116418581
TCexonicPaternalnonsynonymous SNVNM_015335c.A5338Gp.I1780V7.379-Guo2018 T
Wang2016 T
MED13L     12969.p1 Complex Event; expand row to view variants  De novosplicing--Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2014 T
Satterstrom2020 E
Wilfert2021 G
Willsey2013 E
MED13L     M13338chr12:
116413537-116413537
TCexonicPaternalnonsynonymous SNVNM_015335c.A5371Gp.S1791G20.32.52E-5Guo2018 T
Wang2016 T
MED13L     M18927chr12:
116457643-116457643
TCexonicPaternalnonsynonymous SNVNM_015335c.A760Gp.K254E9.2578.248E-6Guo2018 T
Wang2016 T
MED13L     M12368chr12:
116534535-116534535
CTexonicPaternalnonsynonymous SNVNM_015335c.G418Ap.V140I17.671.0E-4Wang2016 T
MED13L     M19729chr12:
116446920-116446920
CTexonicPaternalnonsynonymous SNVNM_015335c.G1298Ap.R433H15.861.655E-5Guo2018 T
Wang2016 T
MED13L     3-0458-000Bchr12:
116624898-116624898
CTintronicDe novo--Yuen2017 G
MED13L     M17691chr12:
116457643-116457643
TCexonicPaternalnonsynonymous SNVNM_015335c.A760Gp.K254E9.2578.248E-6Guo2018 T
Wang2016 T
MED13L     13649.p1chr12:
116499561-116499561
TGintronicDe novo--Turner2016 G
MED13L     M11432chr12:
116440906-116440906
GCexonicMaternal, Unknownnonsynonymous SNVNM_015335c.C2471Gp.A824G16.93-Guo2018 T
Wang2016 T
MED13L     1-0552-003chr12:
116736635-116736635
CTintergenicDe novo--Yuen2017 G
MED13L     1-0282-003chr12:
116429833-116429833
CAintronicDe novo--Yuen2017 G
MED13L     2-1466-003chr12:
116679058-116679058
CTintronicDe novo--Yuen2016 G
MED13L     JASD_Fam0010chr12:
116403994-116403994
GAexonicDe novononsynonymous SNVNM_015335c.C6280Tp.P2094S24.0-Takata2018 E
MED13L     1-0835-003chr12:
116818613-116818648
AAGAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAGAAAGAGAGAGAGAGAGACAGAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
MED13L     M19541chr12:
116403898-116403898
GCexonicPaternalnonsynonymous SNVNM_015335c.C6376Gp.L2126V23.2-Guo2018 T
Wang2016 T
MED13L     M26940chr12:
116445225-116445225
TGexonicMaternal, Unknownnonsynonymous SNVNM_015335c.A2229Cp.K743N13.8-Guo2018 T
Wang2016 T
MED13L     S5K6Bchr12:
116401258-116401258
GAexonicUnknownnonsynonymous SNVNM_015335c.C6454Tp.R2152W22.2-Stessman2017 T
MED13L     2-1322-004chr12:
116507486-116507486
AGintronicDe novo--Yuen2017 G
MED13L     Codina-Sola2015:ASD_9chr12:
116413537-116413537
TAexonicPaternalnonsynonymous SNVNM_015335c.A5371Tp.S1791C20.9-Codina-Sola2015 E
MED13L     1-0025-006chr12:
116625539-116625539
CTintronicDe novo--Yuen2017 G
MED13L     M21769chr12:
116420323-116420323
TCexonicMaternalnonsynonymous SNVNM_015335c.A5041Gp.M1681V23.88.257E-6Wang2016 T
MED13L     M8620chr12:
116446308-116446308
CTexonicMaternalnonsynonymous SNVNM_015335c.G1910Ap.R637H11.791.0E-4Wang2016 T
MED13L     Codina-Sola2015:ASD_11chr12:
116446508-116446510
ACTAexonicDe novoframeshift deletionNM_015335c.1708_1709delp.S570fs--Codina-Sola2015 E
MED13L     1-0804-003chr12:
116759787-116759787
CTintergenicDe novo--Yuen2017 G
MED13L     GX0426.p1chr12:
116434303-116434303
TGexonicMaternalnonsynonymous SNVNM_015335c.A2974Cp.T992P12.73-Guo2018 T
MED13L     SP0018980chr12:
116413093-116413093
GAexonicDe novononsynonymous SNVNM_015335c.C5614Tp.R1872C21.1-Feliciano2019 E
MED13L     GX0071.p1chr12:
116429103-116429103
TGexonicMaternalnonsynonymous SNVNM_015335c.A3656Cp.Q1219P10.63-Guo2018 T
MED13L     GX0213.p1chr12:
116445244-116445244
GAexonicMaternalnonsynonymous SNVNM_015335c.C2210Tp.T737M13.824.943E-5Guo2018 T
MED13L     HN0071.p1chr12:
116444143-116444143
GCexonicMaternalnonsynonymous SNVNM_015335c.C2312Gp.A771G16.258.265E-6Guo2018 T
MED13L     GX0414.p1chr12:
116420283-116420283
GAexonicMaternalnonsynonymous SNVNM_015335c.C5081Tp.T1694I19.06-Guo2018 T
MED13L     GX0264.p1chr12:
116413495-116413495
TCexonicMaternalnonsynonymous SNVNM_015335c.A5413Gp.I1805V8.8174.136E-5Guo2018 T
MED13L     1-0563-004chr12:
116601270-116601271
AGAintronicDe novo--Yuen2017 G
MED13L     2-0132-004chr12:
116550102-116550102
TCintronicDe novo--Yuen2017 G
MED13L     3-0458-000Achr12:
116624898-116624898
CTintronicDe novo--Yuen2017 G
MED13L     GX0191.p1chr12:
116457645-116457645
GAexonicMaternalnonsynonymous SNVNM_015335c.C758Tp.S253L7.177.423E-5Guo2018 T
MED13L     GX0328.p1chr12:
116446329-116446329
TCexonicMaternalnonsynonymous SNVNM_015335c.A1889Gp.E630G12.741.656E-5Guo2018 T
MED13L     GX0486.p1chr12:
116457747-116457747
GAexonicMaternalnonsynonymous SNVNM_015335c.C656Tp.T219M16.892.0E-4Guo2018 T
MED13L     M23263chr12:
116446833-116446833
GAexonicPaternalnonsynonymous SNVNM_015335c.C1385Tp.P462L15.523.295E-5Wang2016 T
MED13L     M16119chr12:
116457645-116457645
GAexonicPaternalnonsynonymous SNVNM_015335c.C758Tp.S253L7.177.423E-5Guo2018 T
Wang2016 T
MED13L     AU076808chr12:
116607073-116607073
ATintronicDe novo--Yuen2017 G
MED13L     2-1398-003chr12:
116655412-116655412
AAAACACGintronicDe novo--Yuen2017 G
MED13L     1-0469-003chr12:
116461716-116461716
CTintronicDe novo--Yuen2017 G
MED13L     M21480chr12:
116413380-116413380
CAexonicMaternalnonsynonymous SNVNM_015335c.G5528Tp.C1843F27.8-Wang2016 T
MED13L     M19792chr12:
116422094-116422094
CAexonicMaternalnonsynonymous SNVNM_015335c.G4422Tp.K1474N17.64-Guo2018 T
Wang2016 T
MED13L     2-1415-004chr12:
116725685-116725685
GTintergenicDe novo--Yuen2017 G
MED13L     M17649chr12:
116418713-116418713
TCexonicPaternal, Unknownnonsynonymous SNVNM_015335c.A5206Gp.M1736V11.012.485E-5Guo2018 T
Wang2016 T
MED13L     M23196 Complex Event; expand row to view variants  De novoframeshift deletionNM_015335
NM_015335
c.2395_2396del
c.2394_2395del
p.Q799fs
p.T798fs
--Guo2018 T
Stessman2017 T
Stessman2017 T
Wang2016 T
MED13L     M21695chr12:
116413426-116413426
CAexonicUnknownnonsynonymous SNVNM_015335c.G5482Tp.V1828L28.99.897E-5Wang2016 T
MED13L     M08620chr12:
116446308-116446308
CTexonicMaternalnonsynonymous SNVNM_015335c.G1910Ap.R637H11.791.0E-4Guo2018 T
MED13L     M20306chr12:
116408522-116408522
ACexonicUnknownnonsynonymous SNVNM_015335c.T5944Gp.S1982A22.18.251E-6Wang2016 T
MED13L     M08121chr12:
116429323-116429323
CTexonicMaternalnonsynonymous SNVNM_015335c.G3436Ap.G1146R19.89-Guo2018 T
MED13L     14416.p1chr12:
116424952-116424952
CTexonicDe novostopgainNM_015335c.G4076Ap.W1359X45.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
O’Roak2014 T
Satterstrom2020 E
Wilfert2021 G
MED13L     M8698chr12:
116413426-116413426
CAexonicUnknownnonsynonymous SNVNM_015335c.G5482Tp.V1828L28.99.897E-5Wang2016 T
MED13L     GX0553.p1chr12:
116406771-116406771
CTexonicPaternalnonsynonymous SNVNM_015335c.G6199Ap.V2067M17.05-Guo2018 T
MED13L     HEN0310.p1chr12:
116399115-116399115
CGexonicPaternalnonsynonymous SNVNM_015335c.G6589Cp.V2197L23.0-Guo2018 T
MED13L     AU3124302chr12:
116750492-116750492
TCintergenicDe novo--Yuen2017 G
MED13L     HEN0102.p1chr12:
116434281-116434281
TCexonicPaternalnonsynonymous SNVNM_015335c.A2996Gp.N999S10.69-Guo2018 T
MED13L     SSC11830chr12:
116424952-116424952
CTexonicDe novostopgainNM_015335c.G4076Ap.W1359X45.0-Lim2017 E
MED13L     SP0037344chr12:
116434883-116434883
TCexonicDe novononsynonymous SNVNM_015335c.A2722Gp.T908A12.75-Feliciano2019 E
MED13L     AU4212303chr12:
116841834-116841834
CTintergenicDe novo--Yuen2017 G
MED13L     AU4308302chr12:
116569664-116569665
TATAAintronicDe novo--Yuen2017 G
MED13L     M12344chr12:
116446617-116446617
CAexonicPaternalnonsynonymous SNVNM_015335c.G1601Tp.R534I14.538.266E-5Guo2018 T
Wang2016 T
MED13L     2-1112-003chr12:
116633183-116633183
GAintronicDe novo--Yuen2016 G
Yuen2017 G
MED13L     07C68434chr12:
116399156-116399156
GAexonicUnknownnonsynonymous SNVNM_015335c.C6548Tp.P2183L32.08.239E-6Stessman2017 T
MED13L     2-1428-003chr12:
116655223-116655223
AGintronicDe novo--Yuen2016 G
Yuen2017 G
MED13L     M13354chr12:
116403973-116403973
CAexonicPaternal, Unknownnonsynonymous SNVNM_015335c.G6301Tp.V2101L35.08.238E-6Guo2018 T
Stessman2017 T
Wang2016 T
MED13L     HN0057.p1chr12:
116418593-116418593
GAexonicPaternalnonsynonymous SNVNM_015335c.C5326Tp.P1776S29.5-Guo2018 T
MED13L     547-09-112297chr12:
116434349-116434349
CTexonicDe novostopgainNM_015335c.G2928Ap.W976X42.0-Satterstrom2020 E
MED13L     3-0458-000chr12:
116624898-116624898
CTintronicDe novo--Yuen2016 G
MED13L     GX0516.p1chr12:
116410005-116410005
GAexonicPaternalnonsynonymous SNVNM_015335c.C5768Tp.T1923I26.82.0E-4Guo2018 T
MED13L     GX0491.p1chr12:
116445394-116445394
TCexonicPaternalnonsynonymous SNVNM_015335c.A2060Gp.Q687R6.9638.239E-6Guo2018 T
MED13L     M30585chr12:
116444143-116444143
GCexonicPaternalnonsynonymous SNVNM_015335c.C2312Gp.A771G16.258.265E-6Guo2018 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More