or
or
Exact

Results for "RIMS1"

Variant Events: 98

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RIMS1     M10093chr6:
72975161-72975161
GAexonicUnknownnonsynonymous SNVNM_014989c.G3263Ap.C1088Y4.4662.504E-5Wang2016 T
RIMS1     1-0998-003chr6:
72772480-72772480
AGintronicDe novo--Yuen2017 G
RIMS1     Husson2020:122chr6:
72922926-72922926
GAsplicingsplicing10.56-Husson2020 E
RIMS1     2-1737-003chr6:
73289658-73289658
GAintergenicDe novo--Yuen2017 G
RIMS1     AU3712302chr6:
73073503-73073503
CTintronicDe novo--Yuen2017 G
RIMS1     09C95446chr6:
73110360-73110360
CGexonicUnknownnonsynonymous SNVNM_001168411
NM_001168408
NM_001168409
NM_001168410
NM_001168407
NM_014989
c.C604G
c.C2398G
c.C2227G
c.C2425G
c.C2983G
c.C5023G
p.R202G
p.R800G
p.R743G
p.R809G
p.R995G
p.R1675G
18.518.287E-6Stessman2017 T
RIMS1     7-0095-004chr6:
73229345-73229345
AGintergenicDe novo--Yuen2017 G
RIMS1     AU2988302chr6:
72762717-72762717
GAintronicDe novo--Yuen2017 G
RIMS1     09C95447chr6:
73110360-73110360
CGexonicUnknownnonsynonymous SNVNM_001168411
NM_001168408
NM_001168409
NM_001168410
NM_001168407
NM_014989
c.C604G
c.C2398G
c.C2227G
c.C2425G
c.C2983G
c.C5023G
p.R202G
p.R800G
p.R743G
p.R809G
p.R995G
p.R1675G
18.518.287E-6Stessman2017 T
RIMS1     M21695chr6:
72984083-72984083
CTexonicPaternalstopgainNM_014989c.C3430Tp.R1144X41.02.0E-4Guo2018 T
Wang2016 T
RIMS1     474-04-100574chr6:
72943444-72943444
AGintronicDe novo-8.117E-5Satterstrom2020 E
RIMS1     M12507chr6:
72678702-72678702
AGexonicPaternalnonsynonymous SNVNM_014989c.A181Gp.M61V11.26-Guo2018 T
RIMS1     2-1366-004chr6:
72778423-72778423
GAintronicDe novo--Yuen2017 G
RIMS1     2-0012-004chr6:
72835640-72835640
CTintronicDe novo--Yuen2017 G
RIMS1     AU4473301chr6:
72918474-72918474
TCintronicDe novo--Yuen2017 G
RIMS1     M04033chr6:
73000446-73000446
AA/GexonicPaternal--Guo2018 T
RIMS1     1-0261-004chr6:
72893973-72893973
AGintronicDe novo--Yuen2017 G
RIMS1     AU3861302chr6:
73003556-73003556
AGintronicDe novo--Yuen2017 G
RIMS1     M20573chr6:
72892206-72892206
GCexonicPaternalnonsynonymous SNVNM_014989c.G1032Cp.K344N14.25-Guo2018 T
RIMS1     M16147chr6:
72926929-72926929
CTexonicMaternalnonsynonymous SNVNM_001168410c.C38Tp.T13I8.035-Guo2018 T
Wang2016 T
RIMS1     M08671 Complex Event; expand row to view variants  Unknownframeshift deletion, frameshift substitutionNM_001168407
NM_001168409
NM_001168410
NM_014989
NM_001168407
NM_001168409
NM_001168410
NM_014989
c.1664_1665del
c.1424_1425del
c.1622_1623del
c.3521_3522del
c.1663_1665T
c.1423_1425T
c.1621_1623T
c.3520_3522T
p.Q555fs
p.Q475fs
p.Q541fs
p.Q1174fs
N/A
N/A
N/A
N/A
--Guo2018 T
Wang2016 T
RIMS1     2-0068-003chr6:
73026651-73026651
CGintronicDe novo--Yuen2017 G
RIMS1     M19770chr6:
72974696-72974697
TAAexonicMaternalstopgainNM_014989c.3135delTp.Y1045X--Wang2016 T
RIMS1     M20687chr6:
72974696-72974697
TATexonicMaternalframeshift deletionNM_014989c.3136delAp.K1046fs-5.0E-4Wang2016 T
RIMS1     M15002chr6:
72892838-72892838
GAexonicPaternalnonsynonymous SNVNM_014989c.G1664Ap.S555N16.62.464E-5Guo2018 T
Wang2016 T
RIMS1     M19761chr6:
72960069-72960069
AGexonicPaternalnonsynonymous SNVNM_001168407
NM_001168408
NM_001168409
NM_001168410
NM_014989
c.A700G
c.A700G
c.A457G
c.A655G
c.A2278G
p.I234V
p.I234V
p.I153V
p.I219V
p.I760V
23.9-Guo2018 T
Wang2016 T
RIMS1     AU3874303chr6:
72690815-72690815
CTintronicDe novo--Yuen2017 G
RIMS1     1-0494-003chr6:
72669276-72669276
TCintronicDe novo--Yuen2017 G
RIMS1     M08757chr6:
72892536-72892536
TA/TexonicUnknown--Guo2018 T
RIMS1     M01493chr6:
72975162-72975162
CAexonicUnknown, De novostopgainNM_014989c.C3264Ap.C1088X37.0-Guo2018 T
Stessman2017 T
Wang2016 T
RIMS1     M15139chr6:
73043394-73043394
CAexonicMaternalnonsynonymous SNVNM_001168407
NM_014989
c.C2182A
c.C4222A
p.L728M
p.L1408M
22.4-Guo2018 T
Wang2016 T
RIMS1     2-1222-003chr6:
73245028-73245028
AGintergenicDe novo--Yuen2017 G
RIMS1     AU2988303chr6:
72762717-72762717
GAintronicDe novo--Yuen2017 G
RIMS1     2-0002-005chr6:
72596396-72596396
GAupstreamDe novo--Yuen2017 G
RIMS1     2-0278-003chr6:
72598386-72598386
CAintronicDe novo--Yuen2017 G
RIMS1     M12434chr6:
72967964-72967964
ATexonicMaternalnonsynonymous SNVNM_001168407
NM_001168408
NM_001168409
NM_001168410
NM_014989
c.A1326T
c.A1329T
c.A1086T
c.A1284T
c.A2907T
p.L442F
p.L443F
p.L362F
p.L428F
p.L969F
17.87-Guo2018 T
Wang2016 T
RIMS1     M12516chr6:
72596754-72596754
CTexonicUnknownnonsynonymous SNVNM_014989c.C28Tp.P10S20.23.0E-4Wang2016 T
RIMS1     M10159chr6:
72960957-72960957
CTexonicUnknownnonsynonymous SNVNM_001168407
NM_001168408
NM_001168409
NM_001168410
NM_014989
c.C1006T
c.C1006T
c.C763T
c.C961T
c.C2584T
p.P336S
p.P336S
p.P255S
p.P321S
p.P862S
20.9-Wang2016 T
RIMS1     M08509chr6:
72596755-72596755
CGexonicMaternalnonsynonymous SNVNM_014989c.C29Gp.P10R17.418.92E-6Guo2018 T
RIMS1     M19770chr6:
72945375-72945375
ATexonicMaternalnonsynonymous SNVNM_001168407
NM_001168408
NM_001168410
NM_014989
c.A223T
c.A223T
c.A178T
c.A1801T
p.I75F
p.I75F
p.I60F
p.I601F
26.2-Guo2018 T
Wang2016 T
RIMS1     M12403chr6:
73100399-73100399
CAexonicPaternalnonsynonymous SNVNM_001168411
NM_001168408
NM_001168409
NM_001168410
NM_001168407
NM_014989
c.C47A
c.C1841A
c.C1670A
c.C1868A
c.C2426A
c.C4466A
p.S16Y
p.S614Y
p.S557Y
p.S623Y
p.S809Y
p.S1489Y
20.5-Guo2018 T
Wang2016 T
RIMS1     M27809chr6:
72892536-72892536
TAexonicMaternal, Unknownnonsynonymous SNVNM_014989c.T1362Ap.H454Q7.91-Guo2018 T
Wang2016 T
RIMS1     13316.p1chr6:
72952021-72952021
TCexonicDe novosynonymous SNVNM_001168407
NM_001168408
NM_001168409
NM_001168410
NM_014989
c.T384C
c.T384C
c.T141C
c.T339C
c.T1962C
p.D128D
p.D128D
p.D47D
p.D113D
p.D654D
5.409-Satterstrom2020 E
RIMS1     2-1373-003chr6:
73016411-73016411
GCintronicDe novo--Yuen2016 G
Yuen2017 G
RIMS1     M04053chr6:
72974707-72974707
CC/TexonicMaternal--Guo2018 T
RIMS1     M15248chr6:
73023290-73023290
GTexonicMaternalnonsynonymous SNVNM_001168407
NM_014989
c.G2005T
c.G4045T
p.A669S
p.A1349S
32.0-Guo2018 T
RIMS1     M19661chr6:
72892249-72892249
CAexonicMaternalnonsynonymous SNVNM_014989c.C1075Ap.P359T22.3-Guo2018 T
RIMS1     7-0127-003chr6:
72801528-72801528
ATintronicDe novo--Yuen2017 G
RIMS1     13497.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_001168411
NM_001168408
NM_001168409
NM_001168410
NM_001168407
NM_014989
c.176dupA
c.1970dupA
c.1799dupA
c.1997dupA
c.2555dupA
c.4595dupA
p.Q59fs
p.Q657fs
p.Q600fs
p.Q666fs
p.Q852fs
p.Q1532fs
--Dong2014 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
RIMS1     13162.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_014989
NM_014989
c.586dupA
c.586dupA
p.D195fs
p.T196fs
--Dong2014 E
Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
Willsey2013 E
RIMS1     3-0185-000chr6:
72864735-72864735
CAintronicDe novo--Yuen2017 G
RIMS1     AU4056301chr6:
73030703-73030703
AGintronicDe novo--Yuen2017 G
RIMS1     2-0272-003chr6:
73066276-73066276
CCATGATGAAACCCCATCTCTACTAAATGTAGintronicDe novo--Yuen2017 G
RIMS1     1-0469-005chr6:
73094595-73094595
TCintronicDe novo--Yuen2017 G
RIMS1     2-1627-003chr6:
73079061-73079061
GAintronicDe novo--Yuen2017 G
RIMS1     5-0074-003chr6:
72789916-72789916
GAintronicDe novo--Yuen2017 G
RIMS1     AU4476302chr6:
73301174-73301174
TCintergenicDe novo--Yuen2017 G
RIMS1     M15013chr6:
72596754-72596754
CTexonicPaternalnonsynonymous SNVNM_014989c.C28Tp.P10S20.23.0E-4Wang2016 T
RIMS1     PN400281chr6:
72892264-72892265
TATexonicUnknownframeshift deletionNM_014989c.1091delAp.Y364fs--Leblond2019 E
RIMS1     M30928chr6:
72962473-72962473
GAexonicMaternalnonsynonymous SNVNM_001168407
NM_001168408
NM_001168409
NM_001168410
NM_014989
c.G1130A
c.G1130A
c.G887A
c.G1085A
c.G2708A
p.R377Q
p.R377Q
p.R296Q
p.R362Q
p.R903Q
32.0-Guo2018 T
RIMS1     D3P6Hchr6:
72892579-72892580
CCCCCexonicInheritedframeshift insertionNM_014989c.1406dupCp.P469fs--Stessman2017 T
RIMS1     1-0068-003chr6:
72599005-72599005
AGintronicDe novo--Yuen2017 G
RIMS1     M8509chr6:
72596755-72596755
CGexonicMaternalnonsynonymous SNVNM_014989c.C29Gp.P10R17.418.92E-6Wang2016 T
RIMS1     GX0245.p1chr6:
72892217-72892217
AGexonicPaternalnonsynonymous SNVNM_014989c.A1043Gp.E348G18.21-Guo2018 T
RIMS1     GX0034.p1chr6:
73000404-73000404
AGexonicDe novononsynonymous SNVNM_014989c.A3577Gp.R1193G21.9-Guo2018 T
RIMS1     1-0300-003chr6:
72736563-72736563
TCintronicDe novo--Yuen2017 G
RIMS1     HN0027.p1chr6:
72926893-72926893
TC/TexonicPaternal--Guo2018 T
RIMS1     M30943chr6:
72926893-72926893
TCexonicPaternalnonsynonymous SNVNM_001168410c.T2Cp.M1T10.1-Guo2018 T
RIMS1     GX0255.p1chr6:
72993800-72993800
GTexonicPaternalnonsynonymous SNVNM_001168407
NM_001168409
NM_001168410
NM_014989
c.G1676T
c.G1436T
c.G1634T
c.G3533T
p.G559V
p.G479V
p.G545V
p.G1178V
10.02-Guo2018 T
RIMS1     GX0291.p1chr6:
72957765-72957765
GAexonicPaternalnonsynonymous SNVNM_001168407
NM_001168408
NM_001168409
NM_001168410
NM_014989
c.G598A
c.G598A
c.G355A
c.G553A
c.G2176A
p.V200I
p.V200I
p.V119I
p.V185I
p.V726I
26.13.316E-5Guo2018 T
RIMS1     H7P2Hchr6:
73100420-73100420
GAexonicInheritednonsynonymous SNVNM_001168411
NM_001168408
NM_001168409
NM_001168410
NM_001168407
NM_014989
c.G68A
c.G1862A
c.G1691A
c.G1889A
c.G2447A
c.G4487A
p.S23N
p.S621N
p.S564N
p.S630N
p.S816N
p.S1496N
32.08.294E-6Stessman2017 T
RIMS1     M12504chr6:
73023290-73023290
GTexonicMaternalnonsynonymous SNVNM_001168407
NM_014989
c.G2005T
c.G4045T
p.A669S
p.A1349S
32.0-Guo2018 T
Wang2016 T
RIMS1     2-1302-003chr6:
72756246-72756246
AGintronicDe novo--Yuen2017 G
RIMS1     1-0494-003Achr6:
72669276-72669276
TCintronicDe novo--Yuen2017 G
RIMS1     M12510chr6:
73023281-73023281
GTexonicMaternal, Unknownnonsynonymous SNVNM_001168407
NM_014989
c.G1996T
c.G4036T
p.D666Y
p.D1346Y
25.7-Guo2018 T
Stessman2017 T
Wang2016 T
RIMS1     M17558chr6:
72984117-72984117
CGexonicPaternalnonsynonymous SNVNM_014989c.C3464Gp.A1155G13.24-Guo2018 T
Wang2016 T
RIMS1     7-0035-003chr6:
72901192-72901192
TAintronicDe novo--Yuen2017 G
RIMS1     2-1315-003chr6:
72779917-72779917
ACintronicDe novo--Yuen2016 G
Yuen2017 G
RIMS1     12076.p1chr6:
73121773-73121773
TCintergenicMosaic--Dou2017 E
RIMS1     M19735chr6:
72892155-72892155
CGexonicMaternalstopgainNM_014989c.C981Gp.Y327X14.71-Guo2018 T
Stessman2017 T
Wang2016 T
RIMS1     M23785chr6:
72967953-72967953
CTexonicMaternal, Unknownnonsynonymous SNVNM_001168407
NM_001168408
NM_001168409
NM_001168410
NM_014989
c.C1315T
c.C1318T
c.C1075T
c.C1273T
c.C2896T
p.R439C
p.R440C
p.R359C
p.R425C
p.R966C
23.78.412E-6Guo2018 T
Stessman2017 T
Wang2016 T
RIMS1     1-0490-003chr6:
73193293-73193293
GAintergenicDe novo--Yuen2017 G
RIMS1     AU3801301chr6:
72632221-72632221
CTintronicDe novo--Yuen2017 G
RIMS1     PN400297chr6:
72970442-72970442
CTexonicUnknownstopgainNM_001168407
NM_001168408
NM_001168409
NM_001168410
NM_014989
c.C1507T
c.C1510T
c.C1267T
c.C1465T
c.C3088T
p.R503X
p.R504X
p.R423X
p.R489X
p.R1030X
45.0-Leblond2019 E
RIMS1     217-14291-4120chr6:
73017033-73017033
CAexonicUnknownnonsynonymous SNVNM_001168407
NM_014989
c.C1883A
c.C3923A
p.S628Y
p.S1308Y
24.81.0E-4Stessman2017 T
RIMS1     M32001chr6:
72968735-72968735
AGexonicMaternalnonsynonymous SNVNM_001168407
NM_001168408
NM_001168409
NM_001168410
NM_014989
c.A1393G
c.A1396G
c.A1153G
c.A1351G
c.A2974G
p.R465G
p.R466G
p.R385G
p.R451G
p.R992G
11.09-Guo2018 T
RIMS1     05C40021chr6:
73110213-73110213
GTexonicUnknownnonsynonymous SNVNM_001168411
NM_001168408
NM_001168409
NM_001168410
NM_001168407
NM_014989
c.G457T
c.G2251T
c.G2080T
c.G2278T
c.G2836T
c.G4876T
p.D153Y
p.D751Y
p.D694Y
p.D760Y
p.D946Y
p.D1626Y
24.08.289E-6Stessman2017 T
RIMS1     GX0195.p1chr6:
73043331-73043331
CTexonicMaternalnonsynonymous SNVNM_001168407
NM_014989
c.C2119T
c.C4159T
p.R707W
p.R1387W
28.33.0E-4Guo2018 T
RIMS1     GX0042.p1chr6:
72993800-72993800
GTexonicMaternalnonsynonymous SNVNM_001168407
NM_001168409
NM_001168410
NM_014989
c.G1676T
c.G1436T
c.G1634T
c.G3533T
p.G559V
p.G479V
p.G545V
p.G1178V
10.02-Guo2018 T
RIMS1     1-0329-004chr6:
73005159-73005159
AGintronicDe novo--Yuen2017 G
RIMS1     05C48492chr6:
73017056-73017056
CTexonicUnknownnonsynonymous SNVNM_001168407
NM_014989
c.C1906T
c.C3946T
p.R636C
p.R1316C
24.43.46E-5Stessman2017 T
RIMS1     05C48975chr6:
72596749-72596749
GAexonicUnknownnonsynonymous SNVNM_014989c.G23Ap.R8H26.1-Stessman2017 T
RIMS1     M18402chr6:
72975161-72975161
GAexonicMaternalnonsynonymous SNVNM_014989c.G3263Ap.C1088Y4.4662.504E-5Wang2016 T
RIMS1     M20652chr6:
72975161-72975161
GAexonicMaternalnonsynonymous SNVNM_014989c.G3263Ap.C1088Y4.4662.504E-5Wang2016 T
RIMS1     M19577chr6:
72889552-72889552
AGexonicMaternalnonsynonymous SNVNM_014989c.A746Gp.Q249R6.495-Guo2018 T
Wang2016 T
RIMS1     1-0473-003chr6:
72765676-72765676
CTintronicDe novo--Yuen2017 G
RIMS1     13660.p1chr6:
72961341-72961341
GCintronicDe novo--Wilfert2021 G
RIMS1     13143.p1chr6:
72893503-72893503
TCintronicDe novo--Wilfert2021 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More