or
or
Exact

Results for "CTNND2"

Variant Events: 97

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CTNND2     AU4264302chr5:
11083187-11083187
AGintronicDe novo--Yuen2017 G
CTNND2     Stessman2017:ASD_1169chr5:
11159769-11159769
CTexonicUnknownstopgainNM_001288716
NM_001288715
NM_001288717
NM_001332
c.G1067A
c.G1805A
c.G779A
c.G2078A
p.W356X
p.W602X
p.W260X
p.W693X
43.0-Stessman2017 T
CTNND2     1-0375-003chr5:
11164619-11164619
CTintronicDe novo--Yuen2016 G
CTNND2     2-1180-003chr5:
12094709-12094709
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
CTNND2     AU056803chr5:
12007549-12007549
ATintergenicDe novo--Yuen2017 G
CTNND2     2-1690-003chr5:
12444643-12444643
AGintergenicDe novo--Yuen2017 G
CTNND2     2-1507-003chr5:
11638248-11638248
CTintronicDe novo--Yuen2017 G
CTNND2     A22chr5:
12307991-12307991
AGintergenicDe novo--Wu2018 G
CTNND2     AU3840302chr5:
12398663-12398663
CTintergenicDe novo--Yuen2017 G
CTNND2     1-0155-003chr5:
12492432-12492432
CGintergenicDe novo--Yuen2017 G
CTNND2     2-1185-003chr5:
11561412-11561412
CTintronicDe novo--Yuen2017 G
CTNND2     11328.p1chr5:
11175102-11175109
TCTATTAATintronicDe novo--Werling2018 G
CTNND2     1-0075-003chr5:
11537130-11537130
CTintronicDe novo--Yuen2017 G
CTNND2     2-1288-003chr5:
12264499-12264499
GAintergenicDe novo--Yuen2017 G
CTNND2     1-0200-004chr5:
11096450-11096450
CTintronicDe novo--Yuen2017 G
CTNND2     1-0394-003chr5:
11753695-11753695
TGintronicDe novo--Yuen2017 G
CTNND2     AU017304chr5:
12069673-12069673
GAintergenicDe novo--Yuen2017 G
CTNND2     1-0138-003chr5:
11003947-11003947
CTintronicDe novo--Yuen2017 G
CTNND2     AU3779301chr5:
11326116-11326116
TCintronicDe novo--Yuen2017 G
CTNND2     AU3517301chr5:
12202592-12202592
GAintergenicDe novo--Yuen2017 G
CTNND2     AU1640302chr5:
10998068-10998068
CGintronicDe novo--Yuen2017 G
CTNND2     A5chr5:
12330667-12330667
TGintergenicDe novo--Wu2018 G
CTNND2     AU4032306chr5:
11850449-11850449
CTintronicDe novo--Yuen2017 G
CTNND2     AU3900302chr5:
11548608-11548608
TGintronicDe novo--Yuen2017 G
CTNND2     7-0219-003chr5:
12185045-12185045
CAintergenicDe novo--Yuen2017 G
CTNND2     M23212chr5:
11022936-11022936
GAexonicUnknownnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1933T
c.C2671T
c.C1645T
c.C2944T
p.R645W
p.R891W
p.R549W
p.R982W
19.171.648E-5Stessman2017 T
CTNND2     2-1522-003chr5:
12496416-12496416
TCintergenicDe novo--Yuen2017 G
CTNND2     1-0305-004chr5:
11130923-11130923
CTintronicDe novo--Yuen2017 G
CTNND2     AU4197302chr5:
11463752-11463752
AGintronicDe novo--Yuen2017 G
CTNND2     AU1352302chr5:
11111014-11111014
CTexonicPaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.G1408A
c.G2146A
c.G1120A
c.G2419A
p.G470R
p.G716R
p.G374R
p.G807R
32.0-Stessman2017 T
CTNND2     2-1245-003chr5:
11910882-11910882
CTintergenicDe novo--Yuen2017 G
CTNND2     AU056204chr5:
11112614-11112614
GAintronicDe novo--Yuen2017 G
CTNND2     211-5259-3chr5:
10992686-10992686
CTexonicPaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.G2177A
c.G2915A
c.G1889A
c.G3188A
p.R726H
p.R972H
p.R630H
p.R1063H
34.09.086E-5Stessman2017 T
CTNND2     2-1085-003chr5:
10985796-10985796
GAintronicDe novo--Yuen2017 G
CTNND2     AU3911301chr5:
12048049-12048049
CTintergenicDe novo--Yuen2017 G
CTNND2     5-0025-004chr5:
11527584-11527584
CGintronicDe novo--Yuen2017 G
CTNND2     M21665chr5:
11159760-11159760
GAexonicUnknownnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1076T
c.C1814T
c.C788T
c.C2087T
p.S359L
p.S605L
p.S263L
p.S696L
34.0-Guo2018 T
CTNND2     1-0007-003chr5:
11481791-11481806
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
CTNND2     1-0007-003chr5:
12550929-12550929
CGintergenicDe novo--Yuen2017 G
CTNND2     1-0567-004chr5:
11968365-11968365
AGintergenicDe novo--Yuen2017 G
CTNND2     AU2333302chr5:
11277321-11277321
AGintronicDe novo--Yuen2017 G
CTNND2     1-0567-004chr5:
11140714-11140714
CCCAAintronicDe novo--Yuen2017 G
CTNND2     AU4176302chr5:
11641931-11641931
TCintronicDe novo--Yuen2017 G
CTNND2     AU2215302chr5:
11985809-11985809
GTintergenicDe novo--Yuen2017 G
CTNND2     2-1223-003chr5:
11086579-11086579
CTintronicDe novo--Yuen2017 G
CTNND2     1-0161-003chr5:
12564753-12564753
GAintergenicDe novo--Yuen2017 G
CTNND2     2-0219-004chr5:
11271632-11271632
GAintronicDe novo--Yuen2017 G
CTNND2     1-0126-003chr5:
12266785-12266785
CTintergenicDe novo--Yuen2017 G
CTNND2     1-0673-003chr5:
12564296-12564296
GCintergenicDe novo--Yuen2017 G
CTNND2     1-0591-003chr5:
12180586-12180586
TCintergenicDe novo--Yuen2017 G
CTNND2     11010.p1chr5:
12038021-12038021
GAintergenicDe novo--Werling2018 G
CTNND2     74-0688chr5:
11405109-11405109
GAintronicDe novo--Michaelson2012 G
CTNND2     1-0493-003chr5:
11519849-11519849
AGintronicDe novo--Yuen2016 G
Yuen2017 G
CTNND2     1-0139-005chr5:
11257007-11257007
TTTTATGTTATGCATAAATGintronicDe novo--Yuen2017 G
CTNND2     M30910chr5:
11159760-11159760
GAexonicMaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1076T
c.C1814T
c.C788T
c.C2087T
p.S359L
p.S605L
p.S263L
p.S696L
34.0-Guo2018 T
CTNND2     AU1894303chr5:
12149720-12149720
CTintergenicDe novo--Yuen2017 G
CTNND2     AU2156303chr5:
12045853-12045853
TCintergenicDe novo--Yuen2017 G
CTNND2     2-1561-003chr5:
11475054-11475054
GAintronicDe novo--Yuen2017 G
CTNND2     AU2525302chr5:
11784440-11784440
CTintronicDe novo--Yuen2017 G
CTNND2     2-0116-005chr5:
11920087-11920087
CGintergenicDe novo--Yuen2017 G
CTNND2     2-1362-004chr5:
11093423-11093423
CTintronicDe novo--Yuen2017 G
CTNND2     2-1368-003chr5:
11846154-11846154
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CTNND2     200675360@1082034754chr5:
11082977-11082977
CTintronicDe novo-4.207E-5Satterstrom2020 E
CTNND2     AU3649305chr5:
11064264-11064264
AGintronicDe novo--Yuen2017 G
CTNND2     1-0246-004chr5:
11491792-11491792
GAintronicDe novo--Yuen2017 G
CTNND2     2-1362-004chr5:
11257007-11257007
TTTTATGTTATGCATAAATGintronicDe novo--Yuen2017 G
CTNND2     1-0448-003chr5:
11807597-11807597
TCintronicDe novo--Yuen2017 G
CTNND2     2-1506-003chr5:
11490406-11490406
GAintronicDe novo--Yuen2017 G
CTNND2     1-0385-003chr5:
11813236-11813238
ACCACintronicDe novo--Yuen2017 G
CTNND2     08C76383chr5:
11022976-11022976
GAexonicDe novosynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1893T
c.C2631T
c.C1605T
c.C2904T
p.H631H
p.H877H
p.H535H
p.H968H
-4.943E-5Satterstrom2020 E
CTNND2     M27815chr5:
11159760-11159760
GAexonicPaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1076T
c.C1814T
c.C788T
c.C2087T
p.S359L
p.S605L
p.S263L
p.S696L
34.0-Guo2018 T
Wang2016 T
CTNND2     2-0070-004chr5:
11313549-11313549
TGintronicDe novo--Yuen2017 G
CTNND2     1-0381-003chr5:
11673583-11673583
CTintronicDe novo--Yuen2017 G
CTNND2     AU005213chr5:
12497829-12497829
GAintergenicDe novo--Yuen2017 G
CTNND2     GX0032.p1chr5:
11565129-11565129
CTexonicPaternalnonsynonymous SNVNM_001332c.G214Ap.E72K36.0-Guo2018 T
CTNND2     2-1508-004chr5:
11644644-11644644
GTintronicDe novo--Yuen2017 G
CTNND2     5-0004-003chr5:
12433658-12433658
TTATTTTCintergenicDe novo--Yuen2017 G
CTNND2     13385.p1chr5:
11477241-11477241
CTintronicDe novo--Wilfert2021 G
CTNND2     2-1376-003chr5:
12140258-12140258
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
CTNND2     5-0083-003chr5:
11467641-11467641
GAintronicDe novo--Yuen2017 G
CTNND2     1-0161-004chr5:
12564753-12564753
GAintergenicDe novo--Yuen2017 G
CTNND2     2-1427-003chr5:
11093778-11093778
TCintronicDe novo--Yuen2017 G
CTNND2     AU069603chr5:
11734717-11734717
TGintronicDe novo--Yuen2017 G
CTNND2     AU3190305chr5:
11558593-11558593
TAintronicDe novo--Yuen2017 G
CTNND2     1-0201-005chr5:
12182328-12182328
CTintergenicDe novo--Yuen2017 G
CTNND2     300449chr5:
11412182-11412183
CTTsplicingInheritedsplicing--Stessman2017 T
CTNND2     AU009904chr5:
11244201-11244201
TCintronicDe novo--Yuen2017 G
CTNND2     2-1605-004chr5:
11603202-11603202
TCintronicDe novo--Yuen2017 G
CTNND2     1-0568-003chr5:
12502990-12502990
TCintergenicDe novo--Yuen2017 G
CTNND2     AU3900301chr5:
11345118-11345118
CAintronicDe novo--Yuen2017 G
CTNND2     05C50297chr5:
11111014-11111014
CTexonicPaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.G1408A
c.G2146A
c.G1120A
c.G2419A
p.G470R
p.G716R
p.G374R
p.G807R
32.0-Stessman2017 T
CTNND2     5-0137-003chr5:
12316702-12316702
ACintergenicDe novo--Yuen2017 G
CTNND2     AU3702307chr5:
11723781-11723781
CTintronicDe novo--Yuen2017 G
CTNND2     AU3790302chr5:
11090080-11090080
CTintronicDe novo--Yuen2017 G
CTNND2     2-1280-003chr5:
12102299-12102299
TCintergenicDe novo--Yuen2017 G
CTNND2     1-0009-004chr5:
12253820-12253820
AGintergenicDe novo--Yuen2017 G
CTNND2     M15228chr5:
11098857-11098857
CTexonicPaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.G1456A
c.G2194A
c.G1168A
c.G2467A
p.D486N
p.D732N
p.D390N
p.D823N
32.0-Guo2018 T
Wang2016 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More