or
or
Exact

Results for "SYNCRIP"

Variant Events: 8

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SYNCRIP     11583.p1chr6:
86324838-86324838
GGCTCCTCTACCACCCCTTCexonicDe novononframeshift insertionNM_001159673
NM_001159675
NM_001159676
NM_001253771
NM_001159674
NM_001159677
NM_006372
c.1213_1214insGAAGGGGTGGTAGAGGAG
c.1402_1403insGAAGGGGTGGTAGAGGAG
c.1507_1508insGAAGGGGTGGTAGAGGAG
c.1051_1052insGAAGGGGTGGTAGAGGAG
c.1402_1403insGAAGGGGTGGTAGAGGAG
c.1507_1508insGAAGGGGTGGTAGAGGAG
c.1507_1508insGAAGGGGTGGTAGAGGAG
p.A405delinsGRGGRGA
p.A468delinsGRGGRGA
p.A503delinsGRGGRGA
p.A351delinsGRGGRGA
p.A468delinsGRGGRGA
p.A503delinsGRGGRGA
p.A503delinsGRGGRGA
--Krumm2015 E
SYNCRIP     AU3913301chr6:
86350505-86350505
CGintronicDe novo--Yuen2017 G
SYNCRIP     14245.p1chr6:
86325066-86325066
CTsplicingDe novosplicing15.55-Wilfert2021 G
SYNCRIP     2-0006-004chr6:
86331128-86331128
GAintronicDe novo--Yuen2017 G
SYNCRIP     2-0242-003chr6:
86383105-86383105
GAintergenicDe novo--Yuen2017 G
SYNCRIP     GX0108.p1chr6:
86324491-86324492
CACexonicUnknownframeshift deletionNM_001159675
NM_006372
c.1749delT
c.1854delT
p.F583fs
p.F618fs
--Guo2018 T
SYNCRIP     1-0193-003chr6:
86334038-86334038
CTintronicDe novo--Yuen2017 G
SYNCRIP     5-0050-003chr6:
86369264-86369264
TGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More