or
or
Exact

Results for "PPP3CA"

Variant Events: 19

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PPP3CA     3-0080-000chr4:
102153832-102153832
GAintronicDe novo--Yuen2016 G
Yuen2017 G
PPP3CA     1-0566-003chr4:
101946066-101946066
GAUTR3De novo--Yuen2017 G
PPP3CA     5-0129-003chr4:
102141828-102141828
CTintronicDe novo--Yuen2017 G
PPP3CA     1-0488-003chr4:
102132873-102132873
GCintronicDe novo--Yuen2017 G
PPP3CA     AU3703302chr4:
101974040-101974040
AGintronicDe novo--Yuen2017 G
PPP3CA     AU3847302chr4:
102148486-102148486
GAintronicDe novo--Yuen2017 G
PPP3CA     Mahjani2021:58chr4:
101947132-101947132
GAexonicnonsynonymous SNVNM_001130692
NM_001130691
NM_000944
c.C1300T
c.C1426T
c.C1456T
p.R434C
p.R476C
p.R486C
20.3-Mahjani2021 E
PPP3CA     1-0273-004chr4:
102147110-102147110
AGintronicDe novo--Yuen2017 G
PPP3CA     1-0290-003chr4:
101988301-101988301
AGintronicDe novo--Yuen2017 G
PPP3CA     2-1265-003chr4:
102152170-102152170
CTintronicDe novo--Yuen2016 G
Yuen2017 G
PPP3CA     2-1466-003chr4:
102042953-102042953
CTintronicDe novo--Yuen2016 G
Yuen2017 G
PPP3CA     2-0202-004chr4:
102164779-102164779
GCintronicDe novo--Yuen2017 G
PPP3CA     2-1529-003chr4:
102268406-102268406
GAUTR5De novo--Yuen2017 G
PPP3CA     2-0285-004chr4:
102231987-102231987
TCintronicDe novo--Yuen2017 G
PPP3CA     AU017703chr4:
102088931-102088931
GTintronicDe novo--Yuen2017 G
PPP3CA     7-0253-004chr4:
102241322-102241338
TCACACACACACACACATCACACACACACACAintronicDe novo--Yuen2017 G
PPP3CA     05HI3588Achr4:
101947055-101947055
GCexonicDe novononsynonymous SNVNM_001130692
NM_001130691
NM_000944
c.C1377G
c.C1503G
c.C1533G
p.D459E
p.D501E
p.D511E
13.75-Satterstrom2020 E
PPP3CA     AU2139305chr4:
101950844-101950848
CTATTCTATTATTintronicDe novo--Yuen2017 G
PPP3CA     AU1894304chr4:
102193503-102193503
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More