or
or
Exact

Results for "Wilfert2021"

Variant Events: 1918

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CACNA2D1     13769.p1chr7:
81662204-81662204
CGexonicDe novononsynonymous SNVNM_000722c.G1052Cp.R351T26.8-Wilfert2021 G
ABCB1     12189.p1chr7:
87145975-87145975
AGexonicDe novosynonymous SNVNM_000927c.T2934Cp.F978F--Wilfert2021 G
ZNF804B     14394.p1chr7:
88389394-88389394
CTexonicDe novononsynonymous SNVNM_181646c.C104Tp.S35F19.94-Wilfert2021 G
AKAP9     14474.p1chr7:
91726153-91726153
CTexonicDe novostopgainNM_005751
NM_147185
c.C9880T
c.C9856T
p.R3294X
p.R3286X
52.01.648E-5Wilfert2021 G
TRRAP     12320.p1chr7:
98550922-98550922
CTexonicDe novononsynonymous SNVNM_003496
NM_001244580
c.C5521T
c.C5575T
p.R1841C
p.R1859C
23.2-Wilfert2021 G
TRRAP     14463.p1chr7:
98609859-98609859
CTexonicDe novononsynonymous SNVNM_003496
NM_001244580
c.C11374T
c.C11461T
p.R3792C
p.R3821C
33.0-Wilfert2021 G
CYP3A43     13236.p1chr7:
99457566-99457566
GAexonicDe novononsynonymous SNVNM_001278921
NM_022820
NM_057095
NM_057096
c.G649A
c.G979A
c.G979A
c.G979A
p.V217I
p.V327I
p.V327I
p.V327I
7.782-Wilfert2021 G
TAF6     13560.p1chr7:
99711308-99711308
TCexonicDe novononsynonymous SNVNM_001190415
NM_005641
NM_139315
c.A439G
c.A328G
c.A328G
p.K147E
p.K110E
p.K110E
15.058.241E-6Wilfert2021 G
TAF6     13732.p1chr7:
99711522-99711522
AGexonicDe novononsynonymous SNVNM_001190415
NM_005641
NM_139315
c.T323C
c.T212C
c.T212C
p.I108T
p.I71T
p.I71T
20.53.295E-5Wilfert2021 G
STAG3     14405.p1chr7:
99802722-99802722
TCexonicDe novononsynonymous SNVNM_001282718
NM_001282716
NM_001282717
NM_012447
c.T2872C
c.T3046C
c.T3046C
c.T3046C
p.S958P
p.S1016P
p.S1016P
p.S1016P
19.971.648E-5Wilfert2021 G
LRCH4     11502.p1chr7:
100183600-100183600
CTexonicDe novononsynonymous SNVNM_001289934
NM_002319
c.G124A
c.G124A
p.V42M
p.V42M
22.5-Wilfert2021 G
GIGYF1     11232.p1chr7:
100283002-100283019
TCCCCATCCCCGTTTGTCTexonicDe novoframeshift deletionNM_022574c.1140_1156delp.G380fs--Wilfert2021 G
SLC12A9     14539.p1chr7:
100460363-100460363
GAexonicDe novononsynonymous SNVNM_001267814
NM_001267812
NM_020246
c.G1505A
c.G1772A
c.G1772A
p.R502H
p.R591H
p.R591H
9.3738.237E-6Wilfert2021 G
ACHE     14533.p1chr7:
100491403-100491403
CTexonicDe novononsynonymous SNVNM_000665
NM_001282449
NM_001302621
NM_001302622
NM_015831
c.G451A
c.G451A
c.G451A
c.G451A
c.G451A
p.G151R
p.G151R
p.G151R
p.G151R
p.G151R
27.7-Wilfert2021 G
PLOD3     11782.p1chr7:
100856461-100856461
CTexonicDe novononsynonymous SNVNM_001084c.G704Ap.R235Q6.1473.374E-5Wilfert2021 G
SLC26A5     11336.p1chr7:
103014942-103014942
GCexonicDe novononsynonymous SNVNM_001167962
NM_198999
c.C2043G
c.C2139G
p.S681R
p.S713R
11.38-Wilfert2021 G
PUS7     13641.p1chr7:
105108895-105108895
GAexonicDe novononsynonymous SNVNM_019042c.C1414Tp.R472C21.2-Wilfert2021 G
LAMB1     13991.p1chr7:
107566657-107566657
CTexonicDe novononsynonymous SNVNM_002291c.G5035Ap.V1679M14.78-Wilfert2021 G
DOCK4     11099.p1chr7:
111398732-111398732
CTexonicDe novononsynonymous SNVNM_014705c.G4250Ap.R1417H17.14.186E-5Wilfert2021 G
CTTNBP2     13918.p1chr7:
117652220-117652220
GGAintergenicDe novo--Wilfert2021 G
PTPRZ1     13971.p1chr7:
121624123-121624123
AGexonicDe novononsynonymous SNVNM_001206838
NM_001206839
NM_002851
c.A880G
c.A880G
c.A880G
p.R294G
p.R294G
p.R294G
9.873-Wilfert2021 G
SCN2A     14525.p1chr2:
166152367-166152367
GAexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.G34A
c.G34A
c.G34A
p.D12N
p.D12N
p.D12N
13.34-Wilfert2021 G
NDUFA5     12031.p1chr7:
123197382-123197382
CGintronicDe novo7.626-Wilfert2021 G
TNPO3     11169.p1chr7:
128622321-128622321
GAexonicDe novononsynonymous SNVNM_001191028
NM_012470
c.C1648T
c.C1840T
p.R550C
p.R614C
20.38.248E-6Wilfert2021 G
STRIP2     14652.p1chr7:
129094327-129094327
GAexonicDe novononsynonymous SNVNM_001134336
NM_020704
c.G665A
c.G665A
p.C222Y
p.C222Y
14.67-Wilfert2021 G
KLHDC10     11838.p1chr7:
129767258-129767258
CTexonicDe novostopgainNM_014997c.C946Tp.R316X37.0-Wilfert2021 G
CNOT4     13415.p1chr7:
135122938-135122938
CTexonicDe novononsynonymous SNVNM_001008225
NM_001190847
NM_001190848
NM_001190849
NM_001190850
NM_013316
c.G142A
c.G142A
c.G142A
c.G142A
c.G142A
c.G142A
p.D48N
p.D48N
p.D48N
p.D48N
p.D48N
p.D48N
21.4-Wilfert2021 G
AGK     13843.p1chr7:
141321569-141321569
GAexonicDe novononsynonymous SNVNM_018238c.G556Ap.E186K20.4-Wilfert2021 G
EPHB6     12681.p1chr7:
142564780-142564780
CTexonicDe novosynonymous SNVNM_001280795
NM_004445
NM_001280794
c.C828T
c.C1704T
c.C828T
p.H276H
p.H568H
p.H276H
-8.323E-6Wilfert2021 G
TRPV5     12839.p1chr7:
142612052-142612052
TGexonicDe novononsynonymous SNVNM_019841c.A1451Cp.K484T26.0-Wilfert2021 G
SCN2A     14280.p1chr2:
166201311-166201311
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C2809T
c.C2809T
c.C2809T
p.R937C
p.R937C
p.R937C
29.0-Wilfert2021 G
NOBOX     11839.p1chr7:
144094582-144094582
CTexonicDe novosynonymous SNVNM_001080413c.G1827Ap.P609P--Wilfert2021 G
SCN2A     11892.p1chr2:
166201379-166201379
CAexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C2877A
c.C2877A
c.C2877A
p.C959X
p.C959X
p.C959X
42.0-Wilfert2021 G
TPK1     13063.p1chr7:
144150703-144150703
CTexonicDe novononsynonymous SNVNM_001042482
NM_022445
c.G520A
c.G667A
p.G174R
p.G223R
29.75.769E-5Wilfert2021 G
SCN2A     11114.p1chr2:
166210819-166210819
GTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.G3037T
c.G3037T
c.G3037T
p.G1013X
p.G1013X
p.G1013X
40.0-Wilfert2021 G
ZNF786     13279.p1chr7:
148777718-148777718
AGexonicDe novononsynonymous SNVNM_152411c.T110Cp.V37A13.88-Wilfert2021 G
KRBA1     11773.p1chr7:
149420891-149420891
CGexonicDe novounknown13.1-Wilfert2021 G
CFAP74     13013.p1chr1:
1911859-1911859
CTintronicPaternal--Wilfert2021 G
SCN2A     13544.p1chr2:
166231378-166231378
TCexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.T4156C
c.T4156C
c.T4156C
p.C1386R
p.C1386R
p.C1386R
15.44-Wilfert2021 G
AGRN     13143.p1chr1:
989900-989900
GAexonicDe novosynonymous SNVNM_198576c.G5949Ap.T1983T--Wilfert2021 G
SCN2A     13642.p1chr2:
166234111-166234111
CTexonicDe novononsynonymous SNVNM_001040143
NM_001040142
NM_021007
c.C4259T
c.C4259T
c.C4259T
p.T1420M
p.T1420M
p.T1420M
28.0-Wilfert2021 G
KMT2C     12742.p1chr7:
151845714-151845714
GAexonicDe novononsynonymous SNVNM_170606c.C13298Tp.A4433V20.1-Wilfert2021 G
KAZN     11063.p1chr1:
15392255-15392256
GCGexonicDe novoframeshift deletionNM_001017999
NM_001018000
NM_001018001
NM_015209
c.947delC
c.1211delC
c.947delC
c.1229delC
p.A316fs
p.A404fs
p.A316fs
p.A410fs
--Wilfert2021 G
DPP6     14523.p1chr7:
154561183-154561183
GAexonicDe novononsynonymous SNVNM_001290252
NM_001039350
NM_001936
NM_130797
c.G619A
c.G748A
c.G754A
c.G940A
p.A207T
p.A250T
p.A252T
p.A314T
22.23.314E-5Wilfert2021 G
TNFRSF8     14441.p1chr1:
12218613-12218613
CTintergenicDe novo--Wilfert2021 G
UBE3C     11006.p1chr7:
157041114-157041114
CTexonicDe novononsynonymous SNVNM_014671c.C2534Tp.S845F21.28.237E-6Wilfert2021 G
MUL1     14416.p1chr1:
20864715-20864715
ACintergenicPaternal--Wilfert2021 G
ACTL8     13637.p1chr1:
18374912-18374912
CTintergenicDe novo--Wilfert2021 G
TTC34     13825.p1chr1:
2720467-2720467
CAintergenicDe novo--Wilfert2021 G
PRKCZ     13143.p1chr1:
2058479-2058479
CTintronicDe novo--Wilfert2021 G
CSMD1     12906.p1chr8:
2965314-2965314
TCexonicDe novononsynonymous SNVNM_033225c.A6761Gp.Q2254R1.421-Wilfert2021 G
CASZ1     14465.p1chr1:
10798964-10798964
CTintronicDe novo--Wilfert2021 G
CASZ1     11604.p1chr1:
10711096-10711097
CGCexonicDe novoframeshift deletionNM_001079843
NM_017766
c.2717delC
c.2717delC
p.P906fs
p.P906fs
--Wilfert2021 G
CSMD1     14695.p1chr8:
3046533-3046533
ATexonicDe novononsynonymous SNVNM_033225c.T5399Ap.V1800E16.27-Wilfert2021 G
CSMD1     14165.p1chr8:
3165969-3165969
GAexonicDe novononsynonymous SNVNM_033225c.C3688Tp.R1230C15.04-Wilfert2021 G
14316.p1chr1:
30992575-30992582
AGAAGATGGGAGGATTintergenicPaternal--Wilfert2021 G
STMN1     12832.p1chr1:
26234201-26234201
TGupstreamDe novo--Wilfert2021 G
AGO3     13133.p1chr1:
36448314-36448314
GTintronicDe novo--Wilfert2021 G
PHC2     14547.p1chr1:
33858459-33858459
GAintergenicDe novo--Wilfert2021 G
ID3     11464.p1chr1:
23886839-23886839
GGCupstreamMaternal--Wilfert2021 G
TNKS     11569.p1chr8:
9567684-9567684
GCexonicDe novononsynonymous SNVNM_003747c.G1703Cp.R568T18.48-Wilfert2021 G
HSPG2     12763.p1chr1:
22263991-22263991
CGupstreamDe novo--Wilfert2021 G
LDLRAP1     13143.p1chr1:
25898899-25898899
CTintergenicDe novo--Wilfert2021 G
XKR6     11415.p1chr8:
10755512-10755512
GAexonicDe novostopgainNM_173683c.C1876Tp.R626X24.3-Wilfert2021 G
MYOM3     13143.p1chr1:
24382501-24382501
TCdownstreamDe novo--Wilfert2021 G
MTMR9     12534.p1chr8:
11172535-11172535
CAexonicDe novononsynonymous SNVNM_015458c.C1075Ap.R359S16.461.648E-5Wilfert2021 G
ATG4C     13043.p1chr1:
63370518-63370519
CTCintergenicDe novo--Wilfert2021 G
NFIA     13043.p1chr1:
61567399-61567400
ATAintronicDe novo--Wilfert2021 G
BLK     11845.p1chr8:
11415531-11415531
TCexonicDe novononsynonymous SNVNM_001715c.T1013Cp.I338T17.594.944E-5Wilfert2021 G
ROR1     12113.p1chr1:
64384525-64384525
GTintronicDe novo--Wilfert2021 G
ATG4C     11835.p1chr1:
63408953-63408953
TCintergenicDe novo--Wilfert2021 G
GATA4     14336.p1chr8:
11607635-11607635
GAexonicDe novononsynonymous SNVNM_001308093
NM_001308094
NM_002052
c.G802A
c.G181A
c.G799A
p.V268M
p.V61M
p.V267M
21.13.0E-4Wilfert2021 G
RNF220     11526.p1chr1:
45025136-45025136
ACintronicDe novo--Wilfert2021 G
HIVEP3     13028.p1chr1:
42118663-42118663
TCintronicDe novo--Wilfert2021 G
SPATA6     13143.p1chr1:
48867296-48867296
CGintronicDe novo--Wilfert2021 G
UQCRH     13143.p1chr1:
46800321-46800321
ACintergenicDe novo--Wilfert2021 G
LOC100129620    14224.p1chr1:
99601894-99601894
CTncRNA_intronicDe novo--Wilfert2021 G
PSD3     11842.p1chr8:
18730164-18730165
TCTexonicDe novoframeshift deletionNM_015310c.209delGp.G70fs--Wilfert2021 G
RPAP2     14091.p1chr1:
92907418-92907418
GCintergenicDe novo--Wilfert2021 G
ZNF697     13673.p1chr1:
120166582-120166582
CCCGGTTCTCCCCAGCACTCTexonicDe novoframeshift insertionNM_001080470c.383_384insAGAGTGCTGGGGAGAACCGp.R128fs--Wilfert2021 G
TBX15     11225.p1chr1:
119499045-119499046
ACTAintronicMaternal--Wilfert2021 G
BMP1     11989.p1chr8:
22067161-22067161
GAexonicDe novononsynonymous SNVNM_006129c.G2779Ap.G927S32.08.254E-6Wilfert2021 G
LINC01360     13952.p1chr1:
74464134-74464134
GCintergenicDe novo--Wilfert2021 G
DNAJC6     11501.p1chr1:
65866790-65866790
GAintronicDe novo--Wilfert2021 G
CYR61     11729.p1chr1:
86102343-86102343
CTintergenicDe novo--Wilfert2021 G
CCAR2     13300.p1chr8:
22463609-22463609
AGexonicDe novononsynonymous SNVNM_021174c.A70Gp.T24A14.844.943E-5Wilfert2021 G
LOC101927434    13143.p1chr1:
81988589-81988589
GTncRNA_intronicDe novo--Wilfert2021 G
EGR3     14049.p1chr8:
22550356-22550356
GAexonicDe novosynonymous SNVNM_004430c.C102Tp.N34N--Wilfert2021 G
POU2F1     14263.p1chr1:
167237318-167237318
CGintronicDe novo--Wilfert2021 G
OLFML2B     11818.p1chr1:
161973172-161973172
GAintronicDe novo--Wilfert2021 G
ASTN1     11544.p1chr1:
177046214-177046214
TCintronicDe novo--Wilfert2021 G
TNFSF4     13143.p1chr1:
173154931-173154931
TGUTR3De novo--Wilfert2021 G
OTUD7B     12150.p1chr1:
149943132-149943132
GTexonicDe novononsynonymous SNVNM_020205c.C133Ap.R45S24.9-Wilfert2021 G
BCL9     12637.p1chr1:
147012822-147012822
CAupstreamDe novo--Wilfert2021 G
FCGR2A     13825.p1chr1:
161479312-161479312
CAintronicDe novo--Wilfert2021 G
KCNN3     11573.p1chr1:
154715328-154715328
GAintronicDe novo--Wilfert2021 G
CAPN2     13486.p1chr1:
223895759-223895761
GTCTTTintronicDe novo--Wilfert2021 G
SUSD4     11729.p1chr1:
223556652-223556652
TCintergenicDe novo--Wilfert2021 G
KCNU1     14670.p1chr8:
36793231-36793231
TCexonicDe novosynonymous SNVNM_001031836c.T3243Cp.V1081V--Wilfert2021 G
OBSCN     12929.p1chr1:
228553400-228553400
CTintronicDe novo--Wilfert2021 G
CNIH3     14541.p1chr1:
224935393-224935393
TGintergenicDe novo--Wilfert2021 G
IPO9-AS1     12061.p1chr1:
201673704-201673704
GAncRNA_intronicDe novo--Wilfert2021 G
IDO2     13204.p1chr8:
39872850-39872850
GAexonicDe novononsynonymous SNVNM_194294c.G992Ap.R331K10.72-Wilfert2021 G
C1orf21     11152.p1chr1:
184539555-184539556
GCTTintronicDe novo--Wilfert2021 G
KAT6A     12108.p1chr8:
41906209-41906213
TTTTGTexonicDe novoframeshift deletionNM_001305878
NM_006766
c.283_286del
c.283_286del
p.Q95fs
p.Q95fs
--Wilfert2021 G
PLXNA2     13037.p1chr1:
209059183-209059183
TGintergenicDe novo--Wilfert2021 G
PLEKHA6     11615.p1chr1:
204329288-204329288
CAupstreamDe novo--Wilfert2021 G
LOC101928272   13143.p1chr10:
9571531-9571531
GAintergenicDe novo--Wilfert2021 G
SPIDR     13766.p1chr8:
48206532-48206532
CTexonicDe novosynonymous SNVNM_001282916
NM_001080394
NM_001282919
c.C228T
c.C438T
c.C258T
p.D76D
p.D146D
p.D86D
--Wilfert2021 G
PRKDC     12266.p1chr8:
48827944-48827944
CAexonicDe novounknown17.63-Wilfert2021 G
PFKFB3     13437.p1chr10:
6229912-6229912
TTTCTATCTATCTATCTAintronicDe novo--Wilfert2021 G
PRKDC     11839.p1chr8:
48849076-48849076
GAexonicDe novounknown20.24.15E-5Wilfert2021 G
GPR158     13825.p1chr10:
25594566-25594566
CTintronicDe novo--Wilfert2021 G
SEPHS1     12497.p1chr10:
13390593-13390595
CAACupstreamDe novo--Wilfert2021 G
PRKDC     13451.p1chr8:
48852146-48852146
AGexonicDe novounknown21.0-Wilfert2021 G
LINC00200     14587.p1chr10:
1205763-1205763
GTncRNA_exonicPaternal--Wilfert2021 G
LINC01139     13143.p1chr1:
239763335-239763338
CCTTCintergenicDe novo--Wilfert2021 G
PXDNL     11841.p1chr8:
52320634-52320634
GAexonicDe novosynonymous SNVNM_144651c.C3550Tp.L1184L--Wilfert2021 G
LOC101927964    13825.p1chr10:
4110160-4110160
CTncRNA_intronicDe novo--Wilfert2021 G
KLF6     13825.p1chr10:
3941894-3941894
ACintergenicDe novo--Wilfert2021 G
TLX1NB     14228.p1chr10:
102890914-102890914
GAncRNA_intronicDe novo--Wilfert2021 G
RAB2A     11077.p1chr8:
61484622-61484622
CTexonicDe novostopgainNM_001242644
NM_002865
c.C64T
c.C136T
p.R22X
p.R46X
28.2-Wilfert2021 G
RBP4     12313.p1chr10:
95365036-95365042
AAATGATAintergenicDe novo--Wilfert2021 G
LOC103344931    11679.p1chr10:
114619254-114619254
CAintergenicDe novo--Wilfert2021 G
CHD7     13733.p1chr8:
61735090-61735090
GAexonicDe novononsynonymous SNVNM_017780c.G2986Ap.G996S33.0-Wilfert2021 G
LINC01435     13486.p1chr10:
110513491-110513491
TCintergenicDe novo--Wilfert2021 G
HK1     13760.p1chr10:
71077992-71077992
GAintronicDe novo--Wilfert2021 G
APBB1IP     12598.p1chr10:
26842859-26842859
ATintronicDe novo--Wilfert2021 G
BTAF1     11025.p1chr10:
93723820-93723851
AACTGATCTTATAGGTGCCCTTCATTATAAATAexonicDe novononframeshift deletionNM_003972c.1405_1422delp.469_474del--Wilfert2021 G
MMRN2     12134.p1chr10:
88705569-88705569
CTintronicDe novo--Wilfert2021 G
LINC01163     13396.p1chr10:
130366962-130366962
AGintergenicDe novo--Wilfert2021 G
LINC01163     13462.p1chr10:
130114415-130114415
TAncRNA_intronicDe novo--Wilfert2021 G
LINC01163     11257.p1chr10:
130367701-130367701
GAintergenicDe novo--Wilfert2021 G
LRRCC1     14385.p1chr8:
86037085-86037085
GAexonicDe novononsynonymous SNVNM_033402c.G1183Ap.A395T6.733-Wilfert2021 G
CA3     11495.p1chr8:
86356323-86356323
GAexonicDe novononsynonymous SNVNM_005181c.G412Ap.D138N27.33.309E-5Wilfert2021 G
LINC01163     12975.p1chr10:
130367682-130367682
TCintergenicDe novo--Wilfert2021 G
FAM53B-AS1   13915.p1chr10:
126399930-126399933
GGGAAGGTncRNA_intronicMaternal--Wilfert2021 G
BUB3     13825.p1chr10:
125382165-125382165
TGintergenicDe novo--Wilfert2021 G
DCAF4L2     14563.p1chr8:
88885654-88885654
GCexonicDe novononsynonymous SNVNM_152418c.C546Gp.I182M12.45-Wilfert2021 G
FOXI2     13825.p1chr10:
129585839-129585839
GAintergenicDe novo--Wilfert2021 G
C10orf90     14093.p1chr10:
128446837-128446837
CCTintergenicDe novo--Wilfert2021 G
RHOG     11954.p1chr11:
3862947-3862947
GAupstreamDe novo--Wilfert2021 G
ESRP1     14073.p1chr8:
95680394-95680394
ACexonicDe novosynonymous SNVNM_001034915
NM_001122825
NM_001122826
NM_001122827
NM_017697
c.A1149C
c.A1149C
c.A1149C
c.A1149C
c.A1149C
p.A383A
p.A383A
p.A383A
p.A383A
p.A383A
9.043-Wilfert2021 G
ADAM8     11251.p1chr10:
135085034-135085034
CCGexonicDe novoframeshift insertionNM_001164490
NM_001109
NM_001164489
c.1164dupC
c.1281dupC
c.1281dupC
p.E389fs
p.E428fs
p.E428fs
-1.0E-4Wilfert2021 G
RGS22     13593.p1chr8:
100990260-100990260
CAexonicDe novononsynonymous SNVNM_001286693
NM_001286692
NM_015668
c.G2861T
c.G3368T
c.G3404T
p.C954F
p.C1123F
p.C1135F
15.73-Wilfert2021 G
NAV2     13948.p1chr11:
19572788-19572788
GAintronicDe novo--Wilfert2021 G
FBXO43     12180.p1chr8:
101153250-101153250
GCexonicDe novononsynonymous SNVNM_001029860c.C1232Gp.A411G0.841-Wilfert2021 G
LOC102724784   14093.p1chr11:
8797684-8797688
CACGTCncRNA_intronicMaternal--Wilfert2021 G
GLRX3     13825.p1chr10:
132418892-132418892
GAintergenicDe novo--Wilfert2021 G
LINC01163     13780.p1chr10:
130996254-130996254
GAintergenicDe novo--Wilfert2021 G
STK32C     11377.p1chr10:
134027769-134027769
TTGGGGGTGintronicMaternal--Wilfert2021 G
RIMS2     12086.p1chr8:
104778570-104778570
GAexonicDe novononsynonymous SNVNM_001100117c.G503Ap.R168Q14.18.285E-6Wilfert2021 G
ZNF462     13842.p1chr9:
109691619-109691619
CTexonicDe novononsynonymous SNVNM_021224c.C5426Tp.A1809V13.271.657E-5Wilfert2021 G
TCERG1L     13143.p1chr10:
132890047-132890047
CTdownstreamDe novo--Wilfert2021 G
PHF21A     13143.p1chr11:
45999278-45999278
GCintronicDe novo--Wilfert2021 G
NUDCD1     13306.p1chr8:
110255473-110255473
GAexonicDe novononsynonymous SNVNM_001128211
NM_032869
c.C1430T
c.C1517T
p.S477L
p.S506L
34.02.475E-5Wilfert2021 G
EBAG9     11824.p1chr8:
110576670-110576670
ATexonicDe novononsynonymous SNVNM_001278938
NM_004215
NM_198120
c.A524T
c.A524T
c.A524T
p.Q175L
p.Q175L
p.Q175L
21.0-Wilfert2021 G
TSPAN18     12671.p1chr11:
44849883-44849883
AGintronicDe novo--Wilfert2021 G
LOC100506127    13853.p1chr11:
76114889-76114889
CTexonicDe novostopgainNM_001282456c.C568Tp.Q190X17.63-Wilfert2021 G
KMT5B     12859.p1chr11:
67933707-67933707
GAUTR3De novo--Wilfert2021 G
DCDC1     11729.p1chr11:
31302563-31302563
GTintronicDe novo--Wilfert2021 G
NELL1     13606.p1chr11:
21883790-21883794
CTTACTTTATintergenicMaternal--Wilfert2021 G
TBC1D31     13975.p1chr8:
124140567-124140567
GCexonicDe novononsynonymous SNVNM_001145088
NM_145647
c.G1931C
c.G1931C
p.R644T
p.R644T
11.91-Wilfert2021 G
LOC100507205   13143.p1chr11:
42872374-42872374
CTintergenicDe novo--Wilfert2021 G
ABTB2     13143.p1chr11:
34328927-34328927
CTintronicDe novo--Wilfert2021 G
KIRREL3     11729.p1chr11:
126352514-126352514
GAintronicDe novo--Wilfert2021 G
TG     11544.p1chr8:
133935689-133935689
CTexonicDe novosynonymous SNVNM_003235c.C4635Tp.D1545D0.0168.243E-6Wilfert2021 G
CLMP     12716.p1chr11:
123008376-123008376
ATintronicDe novo--Wilfert2021 G
NTM     14621.p1chr11:
131475780-131475780
TGintronicDe novo--Wilfert2021 G
LOC101929497    14101.p1chr11:
127153028-127153028
GAncRNA_intronicDe novo--Wilfert2021 G
CARD18     13143.p1chr11:
105011784-105011784
CCAintergenicDe novo--Wilfert2021 G
MROH5     12622.p1chr8:
142458137-142458137
CTexonicDe novounknown-9.636E-6Wilfert2021 G
13143.p1chr11:
104155245-104155245
CGintergenicDe novo--Wilfert2021 G
BSX     11729.p1chr11:
122874190-122874190
GAintergenicDe novo--Wilfert2021 G
TSNARE1     13557.p1chr8:
143356191-143356191
GAexonicDe novononsynonymous SNVNM_001291931
NM_145003
c.C740T
c.C1397T
p.S247L
p.S466L
9.587-Wilfert2021 G
TSNARE1     11411.p1chr8:
143425725-143425725
GCexonicDe novononsynonymous SNVNM_145003c.C347Gp.P116R8.317-Wilfert2021 G
GRIK4     13825.p1chr11:
120674783-120674783
TCintronicDe novo--Wilfert2021 G
LMNTD1     14131.p1chr12:
25735355-25735355
CTintronicDe novo--Wilfert2021 G
SLCO1A2     13143.p1chr12:
21435425-21435425
TTGintronicDe novo--Wilfert2021 G
ADGRB1     13634.p1chr8:
143605599-143605599
CGexonicDe novostopgainNM_001702c.C3246Gp.Y1082X42.0-Wilfert2021 G
AQP5     12597.p1chr12:
50359773-50359773
TCdownstreamDe novo--Wilfert2021 G
GXYLT1     11946.p1chr12:
42538974-42538974
TCupstreamDe novo--Wilfert2021 G
SLC2A14     14416.p1chr12:
7996557-7996562
GTCTTTGintronicPaternal--Wilfert2021 G
PTMS     11257.p1chr12:
6876673-6876673
CTintronicDe novo--Wilfert2021 G
NAPRT     11356.p1chr8:
144659231-144659231
CTsplicingDe novosplicing15.08-Wilfert2021 G
PLEKHA5     14108.p1chr12:
19584957-19584957
CGintergenicDe novo--Wilfert2021 G
DERA     12572.p1chr12:
16308071-16308071
GCintergenicDe novo--Wilfert2021 G
SOCS2     12733.p1chr12:
93965228-93965228
CTintronicDe novo--Wilfert2021 G
ATP2B1-AS1     13637.p1chr12:
90811512-90811512
AGintergenicDe novo--Wilfert2021 G
PARP10     14545.p1chr8:
145059354-145059354
AGexonicDe novosynonymous SNVNM_032789c.T816Cp.A272A--Wilfert2021 G
OPLAH     11518.p1chr8:
145114848-145114848
CTexonicDe novononsynonymous SNVNM_017570c.G88Ap.V30M12.878.484E-6Wilfert2021 G
CORO1C     13750.p1chr12:
109085455-109085455
GAintronicDe novo--Wilfert2021 G
CFAP54     14544.p1chr12:
96915953-96915954
AGAexonicDe novoframeshift deletionNM_001306084c.1145delGp.R382fs--Wilfert2021 G
GRIP1     14404.p1chr12:
67127944-67127944
ACintergenicDe novo--Wilfert2021 G
FBXL6     13063.p1chr8:
145580321-145580321
CTexonicDe novononsynonymous SNVNM_012162
NM_024555
c.G932A
c.G914A
p.R311H
p.R305H
2.2881.667E-5Wilfert2021 G
KRT74     13637.p1chr12:
52961775-52961775
AGintronicDe novo--Wilfert2021 G
KITLG     11729.p1chr12:
89261882-89261882
ATintergenicDe novo--Wilfert2021 G
MFSD3     11776.p1chr8:
145735146-145735146
AAAGCTGGGGGCCGCGCTexonicDe novoframeshift insertionNM_138431c.430_431insAGCTGGGGGCCGCGCTp.K144fs--Wilfert2021 G
MYRFL     13775.p1chr12:
70289233-70289233
ATexonicDe novostopgainNM_182530c.A1063Tp.K355X47.0-Wilfert2021 G
KANK1     11108.p1chr9:
712508-712508
GAexonicDe novononsynonymous SNVNM_153186
NM_015158
NM_001256877
NM_001256876
c.G1268A
c.G1742A
c.G1742A
c.G1742A
p.C423Y
p.C581Y
p.C581Y
p.C581Y
13.378.241E-6Wilfert2021 G
NCOR2     12948.p1chr12:
125106918-125106922
CGTACTGCATintergenicInherited--Wilfert2021 G
SPATA6L     13415.p1chr9:
4605416-4605416
TAexonicDe novosynonymous SNVNM_001039395c.A846Tp.T282T5.743-Wilfert2021 G
KSR2     13825.p1chr12:
118122627-118122627
TCintronicDe novo--Wilfert2021 G
13721.p1chr12:
130600511-130600511
GAintergenicDe novo--Wilfert2021 G
JAK2     12100.p1chr9:
5126467-5126467
CGintronicDe novo--Wilfert2021 G
TMEM132C     14260.p1chr12:
128850406-128850406
TAintronicDe novo--Wilfert2021 G
CUX2     14137.p1chr12:
111757982-111757982
GGCexonicDe novoframeshift insertionNM_015267c.2170dupCp.V723fs--Wilfert2021 G
FOXN4     13637.p1chr12:
109779184-109779184
TAintergenicDe novo--Wilfert2021 G
RIC1     13638.p1chr9:
5769178-5769178
AGexonicDe novononsynonymous SNVNM_001206557
NM_001135920
NM_020829
c.A3235G
c.A3346G
c.A3346G
p.K1079E
p.K1116E
p.K1116E
11.678.25E-6Wilfert2021 G
TBX3     13825.p1chr12:
115878431-115878431
GCintergenicDe novo--Wilfert2021 G
ALDH2     13996.p1chr12:
112236048-112236048
TGsplicingDe novosplicing22.3-Wilfert2021 G
FRY     11060.p1chr13:
32768371-32768371
AACexonicDe novoframeshift insertionNM_023037c.3684dupCp.Y1228fs--Wilfert2021 G
PLUT   14019.p1chr13:
28458573-28458573
AATGTncRNA_intronicDe novo--Wilfert2021 G
STARD13     12303.p1chr13:
33697456-33697456
GAintronicDe novo--Wilfert2021 G
NFIB     14385.p1chr9:
14150143-14150143
CTsplicingDe novosplicing20.8-Wilfert2021 G
FRY     12647.p1chr13:
32832110-32832110
GAintronicDe novo--Wilfert2021 G
ZNF84     12137.p1chr12:
133614131-133614140
TGTGAGTTCATsplicingDe novosplicing--Wilfert2021 G
CCDC171     14575.p1chr9:
15784693-15784693
GAsplicingDe novosplicing19.64-Wilfert2021 G
RIMBP2     13169.p1chr12:
131070869-131070870
CATGintergenicMaternal--Wilfert2021 G
ADAMTSL1     13872.p1chr9:
18721602-18721602
GAexonicDe novononsynonymous SNVNM_001040272c.G1945Ap.V649M19.215.77E-5Wilfert2021 G
PEG10     13604.p1chr7:
94293229-94293229
GAexonicDe novononsynonymous SNVNM_001040152
NM_001172438
NM_001184962
c.G361A
c.G589A
c.G463A
p.V121M
p.V197M
p.V155M
15.64-Wilfert2021 G
TNFRSF19     13637.p1chr13:
24166239-24166239
CTintronicDe novo--Wilfert2021 G
XPO4     13143.p1chr13:
21496579-21496579
CTintergenicDe novo--Wilfert2021 G
MYCBP2     13041.p1chr13:
77750618-77750631
TCAGTTGAAACTACTsplicingDe novosplicing--Wilfert2021 G
ELAVL2     14248.p1chr9:
23692707-23692714
CACGGATGCexonicDe novoframeshift deletionNM_001171195
NM_001171197
NM_004432
c.882_888del
c.882_888del
c.921_927del
p.V294fs
p.V294fs
p.V307fs
--Wilfert2021 G
KLF12     13637.p1chr13:
74383944-74383944
ACintronicDe novo--Wilfert2021 G
TUSC1     14620.p1chr9:
25677688-25677688
CTexonicDe novostopgainNM_001004125c.G632Ap.W211X38.0-Wilfert2021 G
SLITRK6     11729.p1chr13:
86505397-86505397
TCintergenicDe novo--Wilfert2021 G
LINC00333   12102.p1chr13:
85093739-85093739
GAncRNA_intronicDe novo--Wilfert2021 G
ENOX1     13143.p1chr13:
43852353-43852353
CTintronicDe novo--Wilfert2021 G
MIR548F5     11729.p1chr13:
36058659-36058659
AGncRNA_intronicDe novo--Wilfert2021 G
LINC01075   11729.p1chr13:
63083045-63083045
CTintergenicDe novo--Wilfert2021 G
LINC01065   12829.p1chr13:
53976894-53976894
GTintergenicDe novo--Wilfert2021 G
AKAP6     13945.p1chr14:
33404059-33404059
GGAintergenicDe novo--Wilfert2021 G
AKAP6     13825.p1chr14:
32981815-32981815
AGintronicDe novo--Wilfert2021 G
EXD2     14303.p1chr14:
69719806-69719806
CTintergenicDe novo--Wilfert2021 G
LINC00648     11729.p1chr14:
49558842-49558842
GCintergenicDe novo--Wilfert2021 G
GPR180     14329.p1chr13:
95314594-95314594
TCintergenicDe novo--Wilfert2021 G
LINC00433   13454.p1chr13:
89399211-89399213
ATCTTTintergenicMaternal--Wilfert2021 G
AKAP6     14093.p1chr14:
32830259-32830259
CCATATATATATintronicDe novo--Wilfert2021 G
ITGBL1     11729.p1chr13:
102327460-102327460
CGintronicDe novo--Wilfert2021 G
CD72     12630.p1chr9:
35611807-35611807
CTexonicDe novononsynonymous SNVNM_001782c.G944Ap.R315H0.0241.649E-5Wilfert2021 G
PPP4R3A     14423.p1chr14:
91932755-91932755
CTintronicDe novo--Wilfert2021 G
FOXN3     11938.p1chr14:
89951874-89951874
GGGTGTGTGAGAGTAGAGTAAATAATCAintronicMaternal--Wilfert2021 G
RNF38     12056.p1chr9:
36375929-36375929
AGsplicingDe novosplicing20.7-Wilfert2021 G
CDC42BPB