Variant Results

or

or

Results for "ITIH3"

Variant Events: 7

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
ITIH3	Lim2017:70372	chr3: 52836816-52836816	A	G	exonic		De novo	nonsynonymous SNV	NM_002217	c.A1703G	p.E568G	20.4	-	Lim2017 E
ITIH3	70372	chr3: 52836816-52836816	A	G	exonic		De novo	nonsynonymous SNV	NM_002217	c.A1703G	p.E568G	20.4	-	Fu2022 E
ITIH3	1-0383-003	chr3: 52844577-52844596	CTATTATTATTATTATTATT	CTATTATTATTATTATT	intergenic		De novo					-	-	Yuen2017 G
ITIH3	AU1353302	chr3: 52836693-52836693	A	G	exonic		Unknown	nonsynonymous SNV	NM_002217	c.A1580G	p.D527G	16.53	2.0E-4	Chahrour2012 E
ITIH3	13550.p1	chr3: 52836816-52836816	A	G	exonic		De novo	nonsynonymous SNV	NM_002217	c.A1703G	p.E568G	20.4	-	Iossifov2014 E Ji2016 E Kosmicki2017 E Satterstrom2020 E
ITIH3	iHART2845	chr3: 52831873-52831874	TG	T	exonic		Paternal	frameshift deletion	NM_002217	c.591delG	p.L197fs	-	1.281E-5	Ruzzo2019 G
ITIH3	AU1353302	chr3: 52834608-52834608	G	A	exonic		Unknown	nonsynonymous SNV	NM_002217	c.G1130A	p.R377Q	4.479	0.022	Chahrour2012 E

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More