
Results for "SLK"

Variant Events: 12

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
SLK     3-0359-000chr10:
AGintronicDe novo--Trost2022 G
SLK     2-0007-003chr10:
GTTAACTCAAATACCTTTTTintronicDe novo--Trost2022 G
SLK     SP0010857chr10:
AGexonicDe novononsynonymous SNVNM_001304743
2.0-Fu2022 E
Trost2022 G
Zhou2022 GE
SLK     3-0484-000chr10:
ATGTCintronicDe novo--Trost2022 G
SLK     CC1041_203chr10:
SLK     3-0484-000chr10:
GTTAACTCAAATACCTTTTTintronicDe novo--Trost2022 G
SLK     2-0070-004chr10:
GTTAACTCAAATACCTTTTTintronicDe novo--Trost2022 G
SLK     2-1295-003chr10:
CTexonicDe novononsynonymous SNVNM_001304743
29.48.264E-6Jiang2013 G
Yuen2016 G
Yuen2017 G
Zhou2022 GE
SLK     AU3787303chr10:
CTintronicDe novo--Trost2022 G
Yuen2017 G
SLK     1-0665-003chr10:
GATGCTGTGATGCTTGAGTATCGAGTAAAGTTexonicDe novononframeshift substitutionNM_001304743
--Trost2022 G
SLK     1-0330-004chr10:
AGintronicDe novo--Trost2022 G
Yuen2017 G
SLK     AU005213chr10:
TCintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView