or
or
Exact

Results for "ADGRV1"

Variant Events: 61

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADGRV1     SSC06607chr5:
89923398-89923398
ATexonicDe novononsynonymous SNVNM_032119c.A1043Tp.D348V25.5-Lim2017 E
ADGRV1     13856.p1chr5:
89918495-89918495
GAexonicMosaicnonsynonymous SNVNM_032119c.G535Ap.G179R34.01.911E-5Dou2017 E
ADGRV1     SSC06014chr5:
90144469-90144469
AGexonicDe novononsynonymous SNVNM_032119c.A17035Gp.K5679E9.125-Lim2017 E
ADGRV1     SSC02682chr5:
89949288-89949288
GAexonicDe novononsynonymous SNVNM_032119c.G3897Ap.M1299I15.56-Lim2017 E
ADGRV1     AU3859301chr5:
90060419-90060419
GAintronicDe novo--Yuen2017 G
ADGRV1     2-1635-004chr5:
89897004-89897004
ATintronicDe novo--Yuen2017 G
ADGRV1     AU2525302chr5:
90255650-90255650
AGintronicDe novo--Yuen2017 G
ADGRV1     AU3809302chr5:
89953530-89953530
TGintronicDe novo--Yuen2017 G
ADGRV1     74-0115chr5:
90449225-90449225
ATintronicDe novo--Michaelson2012 G
ADGRV1     74-0115chr5:
90449167-90449167
GAexonicDe novononsynonymous SNVNM_032119c.G18754Ap.D6252N24.51.0E-4Michaelson2012 G
ADGRV1     1-0898-003chr5:
90125726-90125726
AGintronicDe novo--Yuen2017 G
ADGRV1     3-0434-000chr5:
90314633-90314633
TGintronicDe novo--Yuen2016 G
Yuen2017 G
ADGRV1     AU1521301chr5:
90224731-90224731
GAintronicDe novo--Yuen2017 G
ADGRV1     AU4379301chr5:
90250366-90250366
CTintronicDe novo--Yuen2017 G
ADGRV1     AU3765303chr5:
89946427-89946427
AGintronicDe novo--Yuen2017 G
ADGRV1     98HI0379Achr5:
90449167-90449167
GAexonicDe novononsynonymous SNVNM_032119c.G18754Ap.D6252N24.51.0E-4Satterstrom2020 E
ADGRV1     1-0059-003chr5:
90006397-90006397
TGintronicDe novo--Yuen2017 G
ADGRV1     1-0627-004chr5:
90536255-90536255
CAintergenicDe novo--Yuen2017 G
ADGRV1     1-0559-003chr5:
89945819-89945819
TTAAintronicDe novo--Yuen2017 G
ADGRV1     5-0147-003chr5:
90487233-90487233
AGintergenicDe novo--Yuen2017 G
ADGRV1     AU1687302chr5:
90064161-90064161
AGintronicDe novo--Yuen2017 G
ADGRV1     3-0446-000chr5:
90284857-90284857
TCintronicDe novo--Yuen2017 G
ADGRV1     AU4186302chr5:
90478690-90478690
CGintergenicDe novo--Yuen2017 G
ADGRV1     2-1182-003chr5:
90281353-90281353
GAintronicDe novo-8.373E-6Yuen2016 G
Yuen2017 G
ADGRV1     1-0638-003chr5:
89945686-89945705
TGAGAGAGAGAGAGAGAGAGTGAGAGAGAGAGAGAGAGintronicDe novo--Yuen2017 G
ADGRV1     iHART1669chr5:
90004686-90004687
ACAexonicPaternalframeshift deletionNM_032119c.8785delCp.L2929fs-8.284E-6Ruzzo2019 G
ADGRV1     iHART1668chr5:
90004686-90004687
ACAexonicPaternalframeshift deletionNM_032119c.8785delCp.L2929fs-8.284E-6Ruzzo2019 G
ADGRV1     iHART2676chr5:
90151630-90151632
CATCexonicPaternalframeshift deletionNM_032119c.17668_17669delp.M5890fs-2.488E-5Ruzzo2019 G
ADGRV1     iHART1192chr5:
90106341-90106341
AATexonicPaternalframeshift insertionNM_032119c.15265dupTp.E5088fs--Ruzzo2019 G
ADGRV1     iHART1931chr5:
89938703-89938703
CTexonicMaternalstopgainNM_032119c.C2398Tp.R800X39.02.507E-5Ruzzo2019 G
ADGRV1     1-0367-003chr5:
90074020-90074037
CGTGTGTGTGTGTGTGTGCGTGTGTGTGTGTGTGintronicDe novo--Yuen2017 G
ADGRV1     iHART2872chr5:
89968540-89968540
GAsplicingPaternalsplicing24.9-Ruzzo2019 G
ADGRV1     AU4149301chr5:
90467470-90467470
TCintergenicDe novo--Yuen2017 G
ADGRV1     iHART1930chr5:
89938703-89938703
CTexonicMaternalstopgainNM_032119c.C2398Tp.R800X39.02.507E-5Ruzzo2019 G
ADGRV1     2-1486-003chr5:
89869668-89869668
CTintronicDe novo--Yuen2016 G
Yuen2017 G
ADGRV1     AU066206chr5:
90514482-90514482
AGintergenicDe novo--Yuen2017 G
ADGRV1     1-0627-006chr5:
90030321-90030321
GTintronicDe novo--Yuen2017 G
ADGRV1     2-1632-003chr5:
90010496-90010496
TAintronicDe novo--Yuen2017 G
ADGRV1     AU2293301chr5:
89958873-89958873
AGintronicDe novo--Yuen2017 G
ADGRV1     SP0009874chr5:
90012409-90012409
GAexonicDe novononsynonymous SNVNM_032119c.G9310Ap.V3104I8.881-Feliciano2019 E
ADGRV1     12832.p1chr5:
90144469-90144469
AGexonicDe novononsynonymous SNVNM_032119c.A17035Gp.K5679E9.125-Krumm2015 E
Satterstrom2020 E
Wilfert2021 G
ADGRV1     AU017704chr5:
90133940-90133940
TCintronicDe novo--Yuen2017 G
ADGRV1     12852.p1chr5:
89923398-89923398
ATexonicDe novononsynonymous SNVNM_032119c.A1043Tp.D348V25.5-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
ADGRV1     A9chr5:
89895585-89895585
AGintronicDe novo--Wu2018 G
ADGRV1     AU017704chr5:
90449997-90449997
TCintronicDe novo--Yuen2017 G
ADGRV1     1-0294-003chr5:
90492841-90492841
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
ADGRV1     2-0109-003chr5:
90527454-90527454
CTintergenicDe novo--Yuen2017 G
ADGRV1     AU1448301chr5:
90319786-90319786
GTintronicDe novo--Yuen2017 G
ADGRV1     1-0568-003chr5:
90198723-90198723
AGintronicDe novo--Yuen2017 G
ADGRV1     14590.p1chr5:
90123942-90123942
AGintronicDe novo--Turner2016 G
ADGRV1     11572.p1chr5:
90266383-90266383
GAintronicDe novo--Turner2016 G
ADGRV1     7-0148-003chr5:
90098051-90098051
GAintronicDe novo--Yuen2017 G
ADGRV1     09C99813chr5:
90281353-90281353
GAintronicDe novo-8.373E-6Satterstrom2020 E
ADGRV1     11484.p1 Complex Event; expand row to view variants  De novononsynonymous SNVNM_032119
NM_032119
c.G3897A
c.G3897C
p.M1299I
p.M1299I
15.56-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Sanders2012 E
Satterstrom2020 E
Wilfert2021 G
ADGRV1     AU1687303chr5:
90064161-90064161
AGintronicDe novo--Yuen2017 G
ADGRV1     2-0307-003chr5:
89888857-89888857
TCintronicDe novo--Yuen2017 G
ADGRV1     AU1995302chr5:
90039405-90039405
CTintronicDe novo--Yuen2017 G
ADGRV1     2-0305-003chr5:
90099823-90099823
GAintronicDe novo--Yuen2017 G
ADGRV1     DEASD_1063_001chr5:
90049642-90049646
TAAAGTexonicDe novoframeshift deletionNM_032119c.11374_11377delp.K3792fs--Satterstrom2020 E
ADGRV1     A4chr5:
90516674-90516674
ACintergenicDe novo--Wu2018 G
ADGRV1     1-0009-004chr5:
90022957-90022957
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More