or
or
Exact

Results for "ADAM18"

Variant Events: 13

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADAM18     12892.p1chr8:
39502957-39502957
GCexonicDe novononsynonymous SNVNM_014237c.G1010Cp.C337S14.07-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
ADAM18     1-0627-004chr8:
39453249-39453249
GTintronicDe novo--Yuen2017 G
ADAM18     1-0286-004chr8:
39512330-39512331
TCTintronicDe novo--Yuen2017 G
ADAM18     1-0225-003chr8:
39533017-39533017
CTintronicDe novo--Yuen2017 G
ADAM18     AU3997302chr8:
39517053-39517054
ATAintronicDe novo--Yuen2017 G
ADAM18     SSC05827chr8:
39502957-39502957
GCexonicDe novononsynonymous SNVNM_014237c.G1010Cp.C337S14.07-Lim2017 E
ADAM18     A12005chr8:
39494781-39494781
AGsplicingUnknownsplicing16.97-Li2017 T
ADAM18     Li2017:18439chr8:
39486920-39486920
CTexonicUnknownstopgainNM_014237c.C550Tp.Q184X37.0-Li2017 T
ADAM18     2-0003-003chr8:
39523235-39523235
TGintronicDe novo--Yuen2017 G
ADAM18     7-0249-003chr8:
39530830-39530849
GTATTATTATTATTATTATTGTATTATTATTATTATTintronicDe novo--Yuen2017 G
ADAM18     7-0077-003chr8:
39455771-39455771
TCintronicDe novo--Yuen2017 G
ADAM18     A26chr8:
39486900-39486900
AAAexonicDe novoframeshift insertionNM_014237c.530dupAp.N177fs--Wu2018 G
ADAM18     A2chr8:
39494781-39494781
AGsplicingDe novosplicing16.97-Wu2018 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More