or
or
Exact

Results for "EOMES"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EOMES     2-1093-003chr3:
27836485-27836485
TCintergenicDe novo--Yuen2017 G
EOMES     iHART2788chr3:
27758694-27758713
CTTCGCTTACAAGCACTGGTCexonicMaternalframeshift deletionNM_001278182
NM_001278183
NM_005442
c.1966_1984del
c.1081_1099del
c.1909_1927del
p.T656fs
p.T361fs
p.T637fs
-1.0E-4Ruzzo2019 G
EOMES     AU3636301chr3:
27857671-27857671
TCintergenicDe novo--Yuen2017 G
EOMES     iHART2300chr3:
27763416-27763417
CGCexonicUnknownframeshift deletionNM_001278182
NM_005442
c.369delC
c.369delC
p.A123fs
p.A123fs
--Ruzzo2019 G
EOMES     iHART2787chr3:
27758694-27758713
CTTCGCTTACAAGCACTGGTCexonicMaternalframeshift deletionNM_001278182
NM_001278183
NM_005442
c.1966_1984del
c.1081_1099del
c.1909_1927del
p.T656fs
p.T361fs
p.T637fs
-1.0E-4Ruzzo2019 G
EOMES     AU4315302chr3:
27820650-27820650
TAintergenicDe novo--Yuen2017 G
EOMES     2-1330-003chr3:
27852348-27852348
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
EOMES     Li2017:20274chr3:
27759060-27759060
GAexonicUnknownnonsynonymous SNVNM_001278182
NM_001278183
NM_005442
c.C1619T
c.C734T
c.C1562T
p.T540M
p.T245M
p.T521M
15.41.647E-5Li2017 T
EOMES     1-0699-003chr3:
27845391-27845391
GAintergenicDe novo--Yuen2017 G
EOMES     Li2017:23749chr3:
27758583-27758583
TCexonicUnknownnonsynonymous SNVNM_001278182
NM_001278183
NM_005442
c.A2096G
c.A1211G
c.A2039G
p.Y699C
p.Y404C
p.Y680C
15.58-Li2017 T
EOMES     1-0466-003chr3:
27836930-27836930
CTintergenicDe novo--Yuen2017 G
EOMES     1-0400-003chr3:
27826316-27826316
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More