or
or
Exact

Results for "VAV2"

Variant Events: 31

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
VAV2     20-0301772-22chr9:
136654367-136654367
GAintronicDe novo-1.652E-5Satterstrom2020 E
VAV2     AU3906301chr9:
136782604-136782604
CTintronicDe novo--Yuen2017 G
VAV2     2-1222-003chr9:
136633668-136633668
CTexonicDe novononsynonymous SNVNM_003371
NM_001134398
c.G2368A
c.G2485A
p.A790T
p.A829T
21.2-Yuen2016 G
Yuen2017 G
VAV2     Li2017:21chr9:
136633641-136633641
GAexonicUnknownnonsynonymous SNVNM_003371
NM_001134398
c.C2395T
c.C2512T
p.R799W
p.R838W
20.05.778E-5Li2017 T
VAV2     2-1549-003chr9:
136818917-136818917
CTintronicDe novo--Yuen2017 G
VAV2     1-0395-004chr9:
136751856-136751856
CTintronicDe novo--Yuen2017 G
VAV2     1-0912-003chr9:
136776118-136776118
GAintronicDe novo--Yuen2017 G
VAV2     A22chr9:
136671227-136671227
TCexonicDe novononsynonymous SNVNM_003371
NM_001134398
c.A797G
c.A812G
p.K266R
p.K271R
18.93-Wu2018 G
VAV2     AU3779301chr9:
136772477-136772477
GAintronicDe novo--Yuen2017 G
VAV2     AU4183301chr9:
136846340-136846340
GAintronicDe novo--Yuen2017 G
VAV2     1-0579-003chr9:
136815633-136815633
GAintronicDe novo--Yuen2017 G
VAV2     1-0282-003chr9:
136887843-136887843
GCintergenicDe novo--Yuen2017 G
VAV2     5-0041-003chr9:
136769035-136769035
GAintronicDe novo--Yuen2017 G
VAV2     1-0381-003chr9:
136749466-136749466
AGintronicDe novo--Yuen2017 G
VAV2     AU3713301chr9:
136879445-136879445
ATintergenicDe novo--Yuen2017 G
VAV2     2-0011-004chr9:
136720781-136720781
GGAAGACCAAAAGGTGGGTCCTTGAAGCCATintronicDe novo--Yuen2017 G
VAV2     2-1258-004chr9:
136799120-136799120
AGintronicDe novo--Yuen2017 G
VAV2     2-0088-003chr9:
136788786-136788786
TCintronicDe novo--Yuen2017 G
VAV2     2-1431-003chr9:
136687850-136687850
GAintronicDe novo--Yuen2016 G
Yuen2017 G
VAV2     AU030804chr9:
136659178-136659178
GAintronicDe novo--Yuen2017 G
VAV2     A16chr9:
136633641-136633641
GAexonicDe novononsynonymous SNVNM_003371
NM_001134398
c.C2395T
c.C2512T
p.R799W
p.R838W
20.05.778E-5Wu2018 G
VAV2     1-0395-003chr9:
136751856-136751856
CTintronicDe novo--Yuen2017 G
VAV2     2-0132-004chr9:
136847329-136847330
AGAintronicDe novo--Yuen2017 G
VAV2     iHART3304chr9:
136653567-136653567
CAexonicDe novononsynonymous SNVNM_003371
NM_001134398
c.G1301T
c.G1316T
p.R434L
p.R439L
29.4-Ruzzo2019 G
VAV2     1-0401-003chr9:
136740404-136740404
CTintronicDe novo--Yuen2017 G
VAV2     1-0346-004chr9:
136792748-136792748
GAintronicDe novo--Yuen2017 G
VAV2     AU072005chr9:
136656528-136656528
GAintronicDe novo--Yuen2017 G
VAV2     2-1169-004chr9:
136679906-136679906
GAintronicDe novo--Yuen2017 G
VAV2     Li2017:16082chr9:
136633641-136633641
GAexonicUnknownnonsynonymous SNVNM_003371
NM_001134398
c.C2395T
c.C2512T
p.R799W
p.R838W
20.05.778E-5Li2017 T
VAV2     1-0706-003chr9:
136727814-136727814
GAintronicDe novo--Yuen2017 G
VAV2     2-1379-003chr9:
136684323-136684323
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More