or
or
Exact

Results for "ERBIN"

Variant Events: 40

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ERBIN     SP0115276chr5:
65317224-65317224
ACintronicDe novo--Fu2022 E
ERBIN     220-9982-202chr5:
65322133-65322133
GAexonicUnknownnonsynonymous SNVNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.G1024A
c.G1024A
c.G1024A
c.G1024A
c.G1024A
c.G1024A
p.G342R
p.G342R
p.G342R
p.G342R
p.G342R
p.G342R
27.2-Stessman2017 T
ERBIN     5-0017-004chr5:
65436615-65436615
CAintergenicDe novo--Yuen2017 G
ERBIN     AU0959302chr5:
65339997-65339997
CAexonicPaternalstopgainNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.C1461A
c.C1461A
c.C1461A
c.C1461A
c.C1461A
c.C1461A
p.Y487X
p.Y487X
p.Y487X
p.Y487X
p.Y487X
p.Y487X
36.0-Stessman2017 T
ERBIN     SP0370077chr5:
65371053-65371053
CTexonicstopgainNM_001253698
NM_001253701
NM_018695
NM_001253697
NM_001253699
c.C3835T
c.C3823T
c.C3835T
c.C3958T
c.C3979T
p.Q1279X
p.Q1275X
p.Q1279X
p.Q1320X
p.Q1327X
20.9-Zhou2022 GE
ERBIN     AU3190305chr5:
65270780-65270780
CGintronicDe novo--Trost2022 G
Yuen2017 G
ERBIN     AU3912302chr5:
65322152-65322154
CTGCexonicPaternalframeshift deletionNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
p.T348fs
p.T348fs
p.T348fs
p.T348fs
p.T348fs
p.T348fs
--Cirnigliaro2023 G
ERBIN     AU0039303chr5:
65253257-65253257
CAintronicDe novo--Trost2022 G
Yuen2017 G
ERBIN     14304_p1chr5:
65334296-65334296
CTexonicDe novononsynonymous SNVNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.C1292T
c.C1292T
c.C1292T
c.C1292T
c.C1292T
c.C1292T
p.P431L
p.P431L
p.P431L
p.P431L
p.P431L
p.P431L
21.0-Fu2022 E
ERBIN     1-0119-004chr5:
65250144-65250144
AGintronicDe novo--Trost2022 G
Yuen2017 G
ERBIN     iHART3227chr5:
65322152-65322154
CTGCexonicPaternalframeshift deletionNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
p.T348fs
p.T348fs
p.T348fs
p.T348fs
p.T348fs
p.T348fs
--Ruzzo2019 G
ERBIN     mAGRE4431chr5:
65339997-65339997
CAexonicPaternalstopgainNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.C1461A
c.C1461A
c.C1461A
c.C1461A
c.C1461A
c.C1461A
p.Y487X
p.Y487X
p.Y487X
p.Y487X
p.Y487X
p.Y487X
36.0-Cirnigliaro2023 G
ERBIN     iHART3230chr5:
65322152-65322154
CTGCexonicPaternalframeshift deletionNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
p.T348fs
p.T348fs
p.T348fs
p.T348fs
p.T348fs
p.T348fs
--Ruzzo2019 G
ERBIN     AU3912303chr5:
65322152-65322154
CTGCexonicPaternalframeshift deletionNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
p.T348fs
p.T348fs
p.T348fs
p.T348fs
p.T348fs
p.T348fs
--Cirnigliaro2023 G
ERBIN     AU4465303chr5:
65382041-65382041
GAintergenicDe novo--Yuen2017 G
ERBIN     2-1353-003chr5:
65408317-65408331
GCACACACACACACAGCACACACACACAintergenicDe novo--Yuen2017 G
ERBIN     14304.p1chr5:
65334296-65334296
CTexonicDe novononsynonymous SNVNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.C1292T
c.C1292T
c.C1292T
c.C1292T
c.C1292T
c.C1292T
p.P431L
p.P431L
p.P431L
p.P431L
p.P431L
p.P431L
21.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wilfert2021 G
Zhou2022 GE
ERBIN     219-2257-1chr5:
65290623-65290623
GTexonicUnknownnonsynonymous SNVNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.G238T
c.G238T
c.G238T
c.G238T
c.G238T
c.G238T
p.D80Y
p.D80Y
p.D80Y
p.D80Y
p.D80Y
p.D80Y
26.2-Stessman2017 T
ERBIN     2-1195-003chr5:
65435456-65435469
GCACACACACACACGCACACACACACintergenicDe novo--Yuen2017 G
ERBIN     2-0304-003chr5:
65401532-65401532
GAintergenicDe novo--Yuen2017 G
ERBIN     AU031203chr5:
65258300-65258300
ACintronicDe novo--Trost2022 G
ERBIN     5-5031-004chr5:
65273311-65273313
GGCGintronicDe novo--Trost2022 G
ERBIN     2-1437-003chr5:
65255888-65255888
TCintronicDe novo--Trost2022 G
ERBIN     AU076808chr5:
65276108-65276108
GAintronicDe novo--Trost2022 G
Yuen2017 G
ERBIN     MSSNG00404-003chr5:
65257283-65257283
CTintronicDe novo--Trost2022 G
ERBIN     3-0142-000chr5:
65255530-65255530
CTintronicDe novo--Trost2022 G
ERBIN     2-1437-003chr5:
65255884-65255884
TTAintronicDe novo--Trost2022 G
ERBIN     10-1019-003chr5:
65222801-65222801
CTintronicDe novo--Trost2022 G
ERBIN     REACH000349chr5:
65247700-65247700
CGintronicDe novo--Trost2022 G
ERBIN     MSSNG00428-003chr5:
65344230-65344230
ACintronicDe novo--Trost2022 G
ERBIN     5-5153-003chr5:
65376792-65376792
TAUTR3De novo--Trost2022 G
ERBIN     5-0123-003chr5:
65330723-65330724
AGAintronicDe novo--Trost2022 G
ERBIN     MSSNG00012-003chr5:
65338755-65338755
CTintronicDe novo--Trost2022 G
ERBIN     MSSNG00103-004chr5:
65286754-65286754
AGintronicDe novo--Trost2022 G
ERBIN     5-0109-003chr5:
65265616-65265616
AGintronicDe novo--Trost2022 G
Yuen2017 G
ERBIN     1-1039-003chr5:
65306492-65306492
TCintronicDe novo--Trost2022 G
ERBIN     Viggiano2022:105.3chr5:
65350373-65350373
GTexonicPaternalnonsynonymous SNVNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.G3227T
c.G3227T
c.G3227T
c.G3227T
c.G3215T
c.G3227T
p.R1076L
p.R1076L
p.R1076L
p.R1076L
p.R1072L
p.R1076L
22.1-Viggiano2022 GT
ERBIN     7-0273-003chr5:
65250786-65250786
AGintronicDe novo--Trost2022 G
Yuen2017 G
ERBIN     NDAR_INVGJ169ZP5_wes1chr5:
65338903-65338903
ATsplicingDe novosplicing19.68-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ERBIN     211-5610-3chr5:
65350583-65350583
GAexonicUnknownnonsynonymous SNVNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.G3437A
c.G3437A
c.G3437A
c.G3437A
c.G3425A
c.G3437A
p.R1146Q
p.R1146Q
p.R1146Q
p.R1146Q
p.R1142Q
p.R1146Q
24.74.128E-5Stessman2017 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More