or
or
Exact

Results for "DEPDC5"

Variant Events: 13

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DEPDC5     AU050704chr22:
32327851-32327852
TATAAintergenicDe novo--Yuen2017 G
DEPDC5     SP0030187chr22:
32229977-32229977
GAintronicDe novo-0.0994Feliciano2019 E
DEPDC5     2-0273-003chr22:
32227777-32227777
CTintronicDe novo--Yuen2017 G
DEPDC5     1-0835-003chr22:
32294573-32294573
GTintronicDe novo--Yuen2017 G
DEPDC5     1423001chr22:
32242798-32242798
TTGintronicDe novo--Satterstrom2020 E
DEPDC5     AU4027306chr22:
32222377-32222386
CTGTTGTTGTCTGTTGTintronicDe novo--Yuen2017 G
DEPDC5     PN400117chr22:
32218692-32218692
CTexonicUnknownnonsynonymous SNVNM_001136029
NM_014662
NM_001242896
c.C2020T
c.C2020T
c.C2020T
p.R674C
p.R674C
p.R674C
18.550.0025Leblond2019 E
DEPDC5     1-0320-004chr22:
32240749-32240773
CCAAGCTGGTCTCAACTCCTGAGTTCintronicDe novo--Yuen2017 G
DEPDC5     AU4485302chr22:
32211358-32211358
AGintronicDe novo--Yuen2017 G
DEPDC5     11089.p1chr22:
32282575-32282575
GAintronicDe novo--Turner2016 G
DEPDC5     2-1295-003chr22:
32289772-32289772
CGintronicDe novo--Yuen2016 G
Yuen2017 G
DEPDC5     11089.p1chr22:
32282584-32282584
AGintronicDe novo--Turner2016 G
DEPDC5     AU048206chr22:
32264686-32264686
TAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More