or
or
Exact

Results for "HS6ST1"

Variant Events: 42

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
HS6ST1     2-0273-003chr2:
129294532-129294532
GAintergenicDe novo--Yuen2017 G
HS6ST1     PN400506chr2:
129075939-129075939
TAexonicUnknownstopgainNM_004807c.A199Tp.K67X37.00.0183Leblond2019 E
HS6ST1     AU076705chr2:
129217506-129217506
TAintergenicDe novo--Yuen2017 G
HS6ST1     SP0002974chr2:
129025783-129025783
GAexonicDe novononsynonymous SNVNM_004807c.C1189Tp.R397C15.744.633E-5Feliciano2019 E
HS6ST1     2-0306-004chr2:
129303746-129303746
ATintergenicDe novo--Yuen2017 G
HS6ST1     AU3875301chr2:
129305583-129305583
GAintergenicDe novo--Yuen2017 G
HS6ST1     AU4103301chr2:
129163062-129163062
AGintergenicDe novo--Yuen2017 G
HS6ST1     PN400464chr2:
129075939-129075939
TAexonicUnknownstopgainNM_004807c.A199Tp.K67X37.00.0183Leblond2019 E
HS6ST1     1-0043-004chr2:
129098837-129098837
GTintergenicDe novo--Yuen2017 G
HS6ST1     PN400350chr2:
129075939-129075939
TAexonicUnknownstopgainNM_004807c.A199Tp.K67X37.00.0183Leblond2019 E
HS6ST1     2-1645-003chr2:
129437457-129437457
GAintergenicDe novo--Yuen2017 G
HS6ST1     AU063004chr2:
129024132-129024132
CTUTR3De novo--Yuen2017 G
HS6ST1     1-0274-004chr2:
129394313-129394313
GTintergenicDe novo--Yuen2017 G
HS6ST1     PN400371chr2:
129075939-129075939
TAexonicUnknownstopgainNM_004807c.A199Tp.K67X37.00.0183Leblond2019 E
HS6ST1     5-0147-003chr2:
129243620-129243622
GACGintergenicDe novo--Yuen2017 G
HS6ST1     12011.p1chr2:
129570784-129570784
ACintergenicDe novo--Turner2016 G
HS6ST1     2-0306-003chr2:
129303746-129303746
ATintergenicDe novo--Yuen2016 G
HS6ST1     13324.p1chr2:
129454724-129454724
ACintergenicDe novo--Turner2016 G
HS6ST1     12011.p1chr2:
129570782-129570782
TCintergenicDe novo--Turner2016 G
HS6ST1     2-1646-003chr2:
129103029-129103029
CAintergenicDe novo--Yuen2017 G
HS6ST1     1-0006-004chr2:
129456332-129456332
TCintergenicDe novo--Yuen2017 G
HS6ST1     AU057503chr2:
129025771-129025771
CTexonicDe novononsynonymous SNVNM_004807c.G1201Ap.E401K24.8-Yuen2017 G
HS6ST1     PN400477chr2:
129075939-129075939
TAexonicUnknownstopgainNM_004807c.A199Tp.K67X37.00.0183Leblond2019 E
HS6ST1     1-0233-004chr2:
129540539-129540546
AGTCCTGGAintergenicDe novo--Yuen2017 G
HS6ST1     2-1265-003chr2:
129232310-129232310
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
HS6ST1     2-0307-003chr2:
129033969-129033969
CTintronicDe novo--Yuen2017 G
HS6ST1     1-0299-004chr2:
129475686-129475714
ATTTGGTTGTTAATGATCTCTTTCTGTGTAintergenicDe novo--Yuen2017 G
HS6ST1     AU047904chr2:
129527618-129527618
GAintergenicDe novo--Yuen2017 G
HS6ST1     AU024105chr2:
129057950-129057950
GAintronicDe novo--Yuen2017 G
HS6ST1     1-0274-003chr2:
129394313-129394313
GTintergenicDe novo--Yuen2017 G
HS6ST1     AU024105chr2:
129245340-129245340
GCintergenicDe novo--Yuen2017 G
HS6ST1     2-1518-003chr2:
129259844-129259844
TCintergenicDe novo--Yuen2017 G
HS6ST1     PN400493chr2:
129075939-129075939
TAexonicUnknownstopgainNM_004807c.A199Tp.K67X37.00.0183Leblond2019 E
HS6ST1     1-0121-003chr2:
129064854-129064854
GAintronicDe novo--Yuen2017 G
HS6ST1     2-1364-003chr2:
129254460-129254460
GCintergenicDe novo--Yuen2017 G
HS6ST1     AU017703chr2:
129102691-129102691
CTintergenicDe novo--Yuen2017 G
HS6ST1     PN400587chr2:
129075939-129075939
TAexonicUnknownstopgainNM_004807c.A199Tp.K67X37.00.0183Leblond2019 E
HS6ST1     1-0465-003achr2:
129098837-129098837
GTintergenicDe novo--Yuen2017 G
HS6ST1     2-1322-003chr2:
129195805-129195805
GTintergenicDe novo--Yuen2017 G
HS6ST1     AU3506302chr2:
129193981-129193981
CGintergenicDe novo--Yuen2017 G
HS6ST1     1-0368-004chr2:
129193990-129193990
CTintergenicDe novo--Yuen2017 G
HS6ST1     AU3809302chr2:
129585151-129585151
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More