or
or
Exact

Results for "CBFA2T3"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CBFA2T3     1-0465-003chr16:
89041571-89041571
GGATCCTCTGCTCCTGACCTGCAGCCATGTCAGAGGTCCintronicDe novo--Yuen2017 G
CBFA2T3     AU2525302chr16:
89034878-89034878
GAintronicDe novo--Yuen2017 G
CBFA2T3     2-0116-004chr16:
89041589-89041589
TTGTCAGAGGTCCACCCTGATCintronicDe novo--Yuen2017 G
CBFA2T3     1-0339-004chr16:
89041542-89041542
GGACCTCCAGCCATGTCAGAGGTCCACCCTGATCCTCTGCTCCTCintronicDe novo--Yuen2017 G
CBFA2T3     2-0299-003chr16:
89112553-89112553
CCCACCATCACCACCATCACCACCATintergenicDe novo--Yuen2017 G
CBFA2T3     AU3881301chr16:
89107839-89107839
GAintergenicDe novo--Yuen2017 G
CBFA2T3     SP0001491chr16:
88958738-88958738
GAexonicDe novononsynonymous SNVNM_175931
NM_005187
c.C277T
c.C535T
p.R93C
p.R179C
17.562.537E-5Feliciano2019 E
CBFA2T3     DEASD_1017_001chr16:
88951655-88951655
GAexonicDe novononsynonymous SNVNM_175931
NM_005187
c.C658T
c.C916T
p.R220C
p.R306C
13.992.939E-5Satterstrom2020 E
CBFA2T3     2-1093-009chr16:
89041619-89041619
CCTintronicDe novo--Yuen2017 G
CBFA2T3     1-0354-006chr16:
89041548-89041548
CCCATGTCAGAGGTCCACCCTGATCCTCTGCTCCACATCTTTintronicDe novo--Yuen2017 G
CBFA2T3     AU030703chr16:
88945000-88945000
CTintronicDe novo--Yuen2017 G
CBFA2T3     AU063005chr16:
89004850-89004850
ACintronicDe novo--Yuen2017 G
CBFA2T3     1-0144-004chr16:
89041650-89041650
GGTCCAintronicDe novo--Yuen2017 G
CBFA2T3     2-1329-003chr16:
88982711-88982719
TGTATGCGTTGTintronicDe novo--Yuen2017 G
CBFA2T3     SP0003327chr16:
88951543-88951543
CTexonicDe novononsynonymous SNVNM_175931
NM_005187
c.G770A
c.G1028A
p.R257H
p.R343H
23.01.744E-5Feliciano2019 E
CBFA2T3     AU3052303chr16:
89018258-89018258
CTintronicDe novo--Yuen2017 G
CBFA2T3     2-1416-003chr16:
89118773-89118773
GAintergenicDe novo--Yuen2017 G
CBFA2T3     1-0325-003chr16:
89071716-89071716
TCintergenicDe novo--Yuen2017 G
CBFA2T3     3-0438-000chr16:
89116267-89116267
GCintergenicDe novo--Yuen2016 G
CBFA2T3     2-1303-003chr16:
89158360-89158360
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
CBFA2T3     1-0153-005chr16:
89041542-89041542
GGACCTGCAGCCATATCAAAGGGCCACCCTGATCCTCTGCTCCTCintronicDe novo--Yuen2017 G
CBFA2T3     2-1174-005Bchr16:
89112572-89112572
AATCATCACCACCATCACCACCATCACCACCATCATCATCATCATCACCATCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More