or
or
Exact

Results for "TTN"

Variant Events: 62

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TTN     11462.p1chr2:
179605302-179605302
GTexonicMosaicnonsynonymous SNVNM_003319
NM_001256850
NM_133432
NM_133437
NM_001267550
c.C11569A
c.C11707A
c.C11944A
c.C12145A
c.C12658A
p.P3857T
p.P3903T
p.P3982T
p.P4049T
p.P4220T
2.579-Krupp2017 E
TTN     2-1134-003chr2:
179681342-179681342
GAintergenicDe novo--Yuen2017 G
TTN     G01-GEA-278-HIchr2:
179638072-179638072
CTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_001256850
NM_001267550
NM_133378
NM_133379
c.G7481A
c.G7481A
c.G7481A
c.G7619A
c.G7619A
c.G7619A
c.G7619A
p.R2494H
p.R2494H
p.R2494H
p.R2540H
p.R2540H
p.R2540H
p.R2540H
11.073.327E-5Satterstrom2020 E
TTN     07C66440chr2:
179587296-179587296
TCintronicDe novo--Satterstrom2020 E
TTN     DEASD_0285_001chr2:
179434864-179434864
CTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G48800A
c.G49175A
c.G49376A
c.G68291A
c.G71072A
c.G75995A
p.G16267D
p.G16392D
p.G16459D
p.G22764D
p.G23691D
p.G25332D
15.27-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
TTN     NDAR_INVTF535UK6_wes1chr2:
179435034-179435034
AGexonicDe novosynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.T48630C
c.T49005C
c.T49206C
c.T68121C
c.T70902C
c.T75825C
p.Y16210Y
p.Y16335Y
p.Y16402Y
p.Y22707Y
p.Y23634Y
p.Y25275Y
--DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
TTN     NDAR_INVHK486VP1_wes1chr2:
179439424-179439424
CAexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G44240T
c.G44615T
c.G44816T
c.G63731T
c.G66512T
c.G71435T
p.G14747V
p.G14872V
p.G14939V
p.G21244V
p.G22171V
p.G23812V
9.033-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
TTN     NDAR_INVXB589YLR_wes1chr2:
179575512-179575512
GAexonicDe novostopgainNM_133378
NM_001256850
NM_001267550
c.C24580T
c.C27361T
c.C28312T
p.R8194X
p.R9121X
p.R9438X
60.0-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
TTN     NDAR_INVVJ310ZZ1_wes1chr2:
179582496-179582496
CTexonicDe novononsynonymous SNVNM_133378
NM_001256850
NM_001267550
c.G21373A
c.G24154A
c.G25105A
p.V7125I
p.V8052I
p.V8369I
8.958-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
TTN     DEASD_0097_001chr2:
179584745-179584745
CTexonicDe novononsynonymous SNVNM_133378
NM_001256850
NM_001267550
c.G19892A
c.G22673A
c.G23624A
p.G6631E
p.G7558E
p.G7875E
13.18-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
TTN     UK10K_SKUSE5080165chr2:
179634424-179634424
CGexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_001256850
NM_001267550
NM_133378
NM_133379
c.G8746C
c.G8746C
c.G8746C
c.G8884C
c.G8884C
c.G8884C
c.G8884C
p.A2916P
p.A2916P
p.A2916P
p.A2962P
p.A2962P
p.A2962P
p.A2962P
14.640.0017DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
TTN     AU142Achr2:
179641336-179641336
CTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_001256850
NM_001267550
NM_133378
NM_133379
c.G5117A
c.G5117A
c.G5117A
c.G5255A
c.G5255A
c.G5255A
c.G5255A
p.R1706H
p.R1706H
p.R1706H
p.R1752H
p.R1752H
p.R1752H
p.R1752H
13.22.0E-4DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
TTN     Lim2017:70540chr2:
179486354-179486354
CGexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G18002C
c.G18377C
c.G18578C
c.G37493C
c.G40274C
c.G45197C
p.G6001A
p.G6126A
p.G6193A
p.G12498A
p.G13425A
p.G15066A
16.17-Lim2017 E
TTN     SSC03561chr2:
179452804-179452804
CTexonicDe novosynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G36135A
c.G36510A
c.G36711A
c.G55626A
c.G58407A
c.G63330A
p.A12045A
p.A12170A
p.A12237A
p.A18542A
p.A19469A
p.A21110A
-6.664E-5Lim2017 E
TTN     JASD_Fam0079chr2:
179428473-179428473
CTexonicDe novosynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G55191A
c.G55566A
c.G55767A
c.G74682A
c.G77463A
c.G82386A
p.T18397T
p.T18522T
p.T18589T
p.T24894T
p.T25821T
p.T27462T
-1.658E-5Takata2018 E
TTN     SSC10846chr2:
179666976-179666976
GAexonicDe novononsynonymous SNVNM_001256850
NM_001267550
NM_003319
NM_133378
NM_133379
NM_133432
NM_133437
c.C184T
c.C184T
c.C184T
c.C184T
c.C184T
c.C184T
c.C184T
p.R62C
p.R62C
p.R62C
p.R62C
p.R62C
p.R62C
p.R62C
18.741.648E-5Lim2017 E
TTN     SSC06404chr2:
179447820-179447820
GTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.C38515A
c.C38890A
c.C39091A
c.C58006A
c.C60787A
c.C65710A
p.L12839I
p.L12964I
p.L13031I
p.L19336I
p.L20263I
p.L21904I
13.75-Lim2017 E
TTN     Lim2017:68695chr2:
179425280-179425280
CTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G58384A
c.G58759A
c.G58960A
c.G77875A
c.G80656A
c.G85579A
p.G19462S
p.G19587S
p.G19654S
p.G25959S
p.G26886S
p.G28527S
17.06-Lim2017 E
TTN     1-0271-003chr2:
179621919-179621919
AAAGTAACACTGTACTTGCTTTAAGTACintronicDe novo--Yuen2017 G
TTN     SP0043623chr2:
179397985-179397985
CTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G76162A
c.G76537A
c.G76738A
c.G95653A
c.G98434A
c.G103357A
p.V25388M
p.V25513M
p.V25580M
p.V31885M
p.V32812M
p.V34453M
18.67-Feliciano2019 E
TTN     SP0022147chr2:
179528361-179528361
AGexonicDe novosynonymous SNVNM_001267550c.T36525Cp.P12175P5.454-Feliciano2019 E
TTN     07C69183chr2:
179632633-179632633
CTexonicDe novosynonymous SNVNM_003319
NM_133432
NM_133437
NM_001256850
NM_001267550
NM_133378
NM_133379
c.G9186A
c.G9186A
c.G9186A
c.G9324A
c.G9324A
c.G9324A
c.G9324A
p.E3062E
p.E3062E
p.E3062E
p.E3108E
p.E3108E
p.E3108E
p.E3108E
--Satterstrom2020 E
TTN     1-0458-003chr2:
179581673-179581673
TAintronicDe novo--Yuen2017 G
TTN     SP0037023chr2:
179474028-179474028
GAexonicDe novostopgainNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.C24814T
c.C25189T
c.C25390T
c.C44305T
c.C47086T
c.C52009T
p.R8272X
p.R8397X
p.R8464X
p.R14769X
p.R15696X
p.R17337X
60.0-Feliciano2019 E
TTN     G01-GEA-95-HIchr2:
179611866-179611932
GGGTGTGGAATATCTCTCTAGAGTCTCTCCTGGGGGTGTGGAGTATCTCTCTAGAGTCTCTCCTGGAGexonicDe novononframeshift deletionNM_133379c.15195_15260delp.5065_5087del-2.508E-5Satterstrom2020 E
TTN     1706001chr2:
179631066-179631066
CTintronicDe novo--Satterstrom2020 E
TTN     SP0001383chr2:
179615563-179615563
AGexonicDe novononsynonymous SNVNM_133379c.T11564Cp.I3855T2.604-Feliciano2019 E
TTN     G01-GEA-62-HIchr2:
179587173-179587173
GTexonicDe novosynonymous SNVNM_133378
NM_001256850
NM_001267550
c.C18609A
c.C21390A
c.C22341A
p.P6203P
p.P7130P
p.P7447P
--Lim2017 E
Satterstrom2020 E
TTN     iHART2900chr2:
179472176-179472176
TCexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.A26044G
c.A26419G
c.A26620G
c.A45535G
c.A48316G
c.A53239G
p.T8682A
p.T8807A
p.T8874A
p.T15179A
p.T16106A
p.T17747A
10.16-Ruzzo2019 G
TTN     12323.p1chr2:
179447820-179447820
GTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.C38515A
c.C38890A
c.C39091A
c.C58006A
c.C60787A
c.C65710A
p.L12839I
p.L12964I
p.L13031I
p.L19336I
p.L20263I
p.L21904I
13.75-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
TTN     3-0469-000chr2:
179529237-179529237
GAexonicDe novononsynonymous SNVNM_001267550c.C36230Tp.P12077L11.268.702E-6Yuen2017 G
TTN     iHART1470chr2:
179553483-179553509
AACAGTTTTCTTAGAGACTTCAGCTTTAexonicPaternalframeshift deletionNM_133378
NM_001256850
NM_001267550
c.28364_28385del
c.31145_31166del
c.32096_32117del
p.A9455fs
p.A10382fs
p.A10699fs
--Ruzzo2019 G
TTN     iHART2564chr2:
179516391-179516391
AGsplicingPaternalsplicing7.983-Ruzzo2019 G
TTN     iHART2303chr2:
179477885-179477886
TATsplicingMaternalsplicing-8.509E-6Ruzzo2019 G
TTN     iHART2545chr2:
179535816-179535816
CTsplicingMaternalsplicing18.83-Ruzzo2019 G
TTN     iHART3297chr2:
179528352-179528352
ACsplicingPaternalsplicing15.28-Ruzzo2019 G
TTN     1-0073-003chr2:
179637530-179637530
ACintronicDe novo--Yuen2017 G
TTN     A49chr2:
179469622-179469622
CTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G26999A
c.G27374A
c.G27575A
c.G46490A
c.G49271A
c.G54194A
p.R9000H
p.R9125H
p.R9192H
p.R15497H
p.R16424H
p.R18065H
15.869.282E-5Jiao2019 E
TTN     08C78485chr2:
179592011-179592011
GTexonicDe novononsynonymous SNVNM_133378
NM_001256850
NM_001267550
c.C16349A
c.C19130A
c.C20081A
p.S5450Y
p.S6377Y
p.S6694Y
10.17-Satterstrom2020 E
TTN     09C83896chr2:
179598582-179598582
AGexonicDe novosynonymous SNVNM_133378
NM_001256850
NM_001267550
c.T11802C
c.T14583C
c.T15534C
p.I3934I
p.I4861I
p.I5178I
--Satterstrom2020 E
TTN     07C69336chr2:
179437013-179437013
GAexonicDe novostopgainNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.C46651T
c.C47026T
c.C47227T
c.C66142T
c.C68923T
c.C73846T
p.R15551X
p.R15676X
p.R15743X
p.R22048X
p.R22975X
p.R24616X
63.0-Satterstrom2020 E
TTN     1-0652-003chr2:
179566399-179566399
CGintronicDe novo--Yuen2017 G
TTN     12385.p1chr2:
179425280-179425280
CTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G58384A
c.G58759A
c.G58960A
c.G77875A
c.G80656A
c.G85579A
p.G19462S
p.G19587S
p.G19654S
p.G25959S
p.G26886S
p.G28527S
17.06-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
TTN     13557.p1chr2:
179436520-179436520
CTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G47144A
c.G47519A
c.G47720A
c.G66635A
c.G69416A
c.G74339A
p.R15715Q
p.R15840Q
p.R15907Q
p.R22212Q
p.R23139Q
p.R24780Q
18.131.66E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
TTN     SP0020624chr2:
179425733-179425733
TGexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.A57931C
c.A58306C
c.A58507C
c.A77422C
c.A80203C
c.A85126C
p.K19311Q
p.K19436Q
p.K19503Q
p.K25808Q
p.K26735Q
p.K28376Q
13.371.657E-5Feliciano2019 E
TTN     13284.p1chr2:
179437710-179437710
CTexonicDe novosynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G45954A
c.G46329A
c.G46530A
c.G65445A
c.G68226A
c.G73149A
p.S15318S
p.S15443S
p.S15510S
p.S21815S
p.S22742S
p.S24383S
-4.189E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
TTN     12096.p1chr2:
179452804-179452804
CTexonicDe novosynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G36135A
c.G36510A
c.G36711A
c.G55626A
c.G58407A
c.G63330A
p.A12045A
p.A12170A
p.A12237A
p.A18542A
p.A19469A
p.A21110A
-6.664E-5Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
TTN     13398.p1chr2:
179592329-179592329
GAexonicMosaic, De novononsynonymous SNVNM_133378
NM_001256850
NM_001267550
c.C16244T
c.C19025T
c.C19976T
p.T5415M
p.T6342M
p.T6659M
12.50.0039Dou2017 E
Iossifov2012 E
TTN     14091.p1chr2:
179472552-179472552
CAexonicDe novosynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G25767T
c.G26142T
c.G26343T
c.G45258T
c.G48039T
c.G52962T
p.P8589P
p.P8714P
p.P8781P
p.P15086P
p.P16013P
p.P17654P
--Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
TTN     13412.p1chr2:
179407526-179407526
CTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G69860A
c.G70235A
c.G70436A
c.G89351A
c.G92132A
c.G97055A
p.R23287H
p.R23412H
p.R23479H
p.R29784H
p.R30711H
p.R32352H
23.46.63E-5Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
TTN     14313.p1chr2:
179481591-179481591
CTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G20830A
c.G21205A
c.G21406A
c.G40321A
c.G43102A
c.G48025A
p.V6944M
p.V7069M
p.V7136M
p.V13441M
p.V14368M
p.V16009M
11.29-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
TTN     12369.p1chr2:
179647546-179647546
AGexonicMosaicsynonymous SNVNM_003319
NM_133432
NM_133437
NM_001256850
NM_001267550
NM_133378
NM_133379
c.T2949C
c.T2949C
c.T2949C
c.T3087C
c.T3087C
c.T3087C
c.T3087C
p.Y983Y
p.Y983Y
p.Y983Y
p.Y1029Y
p.Y1029Y
p.Y1029Y
p.Y1029Y
-0.0745Dou2017 E
TTN     14673.p1chr2:
179486354-179486354
CGexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G18002C
c.G18377C
c.G18578C
c.G37493C
c.G40274C
c.G45197C
p.G6001A
p.G6126A
p.G6193A
p.G12498A
p.G13425A
p.G15066A
16.17-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
TTN     14697.p1chr2:
179588185-179588185
GAexonicDe novosynonymous SNVNM_133378
NM_001256850
NM_001267550
c.C17910T
c.C20691T
c.C21642T
p.N5970N
p.N6897N
p.N7214N
-6.724E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
TTN     11025.p1chr2:
179604758-179604758
CTexonicMosaic, De novononsynonymous SNVNM_003319
NM_001256850
NM_133432
NM_133437
NM_001267550
c.G12113A
c.G12251A
c.G12488A
c.G12689A
c.G13202A
p.R4038Q
p.R4084Q
p.R4163Q
p.R4230Q
p.R4401Q
10.165.0E-4Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
TTN     14275.p1chr2:
179666976-179666976
GAexonicDe novononsynonymous SNVNM_001256850
NM_001267550
NM_003319
NM_133378
NM_133379
NM_133432
NM_133437
c.C184T
c.C184T
c.C184T
c.C184T
c.C184T
c.C184T
c.C184T
p.R62C
p.R62C
p.R62C
p.R62C
p.R62C
p.R62C
p.R62C
18.741.648E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
TTN     1658001chr2:
179635170-179635170
CTexonicDe novosynonymous SNVNM_003319
NM_133432
NM_133437
NM_001256850
NM_001267550
NM_133378
NM_133379
c.G8211A
c.G8211A
c.G8211A
c.G8349A
c.G8349A
c.G8349A
c.G8349A
p.R2737R
p.R2737R
p.R2737R
p.R2783R
p.R2783R
p.R2783R
p.R2783R
--Satterstrom2020 E
TTN     09C96031chr2:
179545104-179545104
ACintronicDe novo-0.0032Kosmicki2017 E
TTN     AC02-1197-01chr2:
179545104-179545104
ACintronicDe novo-0.0032Kosmicki2017 E
TTN     08C74827chr2:
179436520-179436520
CTexonicDe novononsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G47144A
c.G47519A
c.G47720A
c.G66635A
c.G69416A
c.G74339A
p.R15715Q
p.R15840Q
p.R15907Q
p.R22212Q
p.R23139Q
p.R24780Q
18.131.66E-5Satterstrom2020 E
TTN     11488.p1chr2:
179396737-179396737
CTexonicMosaicnonsynonymous SNVNM_003319
NM_133432
NM_133437
NM_133378
NM_001256850
NM_001267550
c.G77410A
c.G77785A
c.G77986A
c.G96901A
c.G99682A
c.G104605A
p.E25804K
p.E25929K
p.E25996K
p.E32301K
p.E33228K
p.E34869K
14.798.349E-6Dou2017 E
TTN     1-0329-003chr2:
179615843-179615843
CAexonicDe novononsynonymous SNVNM_133379c.G11284Tp.V3762L11.54-Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More