or
or
Exact

Results for "THOP1"

Variant Events: 8

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
THOP1     AU3777302chr19:
2799624-2799624
TCintronicDe novo--Yuen2017 G
THOP1     iHART2997chr19:
2813141-2813141
TTGAexonicPaternalframeshift insertionNM_003249c.1937_1938insGAp.L646fs--Ruzzo2019 G
THOP1     iHART2998chr19:
2813141-2813141
TTGAexonicPaternalframeshift insertionNM_003249c.1937_1938insGAp.L646fs--Ruzzo2019 G
THOP1     SP0010081chr19:
2810714-2810714
CTexonicDe novosynonymous SNVNM_003249c.C1719Tp.A573A-0.0059Feliciano2019 E
THOP1     80001104634chr19:
2810437-2810437
GAexonicDe novononsynonymous SNVNM_003249c.G1591Ap.V531M13.057.282E-5Satterstrom2020 E
THOP1     1-0388-003chr19:
2804590-2804590
CTintronicDe novo--Yuen2017 G
THOP1     iHART1483chr19:
2811717-2811846
TGTCCTGAACAGCAAGGTACGCGGGGACTGGGGACAGGGAGGGCGTCCTGAACGGCAAGGTACGCGGGGACTGGGGACAGGGAGGGCGTCCTGAATGGCAAGGTACGCGGGGACTGGGGACAGGGAGGGCTexonicMaternalnonframeshift deletionNM_003249c.1894_1908delp.632_636del--Ruzzo2019 G
THOP1     13616.p1chr19:
2805120-2805120
CTexonicDe novosynonymous SNVNM_003249c.C696Tp.H232H-4.401E-5Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More